GOS 1053020

From Metagenes

Jump to: navigation, search
Warning: this metagenomic sequence has been carefully annotated by students during bioinformatics assignments. These quality annotations are therefore the result of a teaching exercise that you are most welcome to amend and extend if necessary!

Annotathon code: GOS_1053020
Sample :
  • GPS :31°10'30n; 64°19'27.6w
  • Sargasso Sea: Sargasso Sea, Station 11 - Bermuda (UK)
  • Open Ocean (-5m, 20.5°C, 0.1-0.8 microns)
Team : Orsay 2009
Username : Renan
Annotated on : 2010-01-21 09:15:09
  • Sauteraud Renan



  • Taxonomy: Shewanellaceae (NCBI info)
    Rank: family - Genetic Code: Bacterial and Plant Plastid - NCBI Identifier: 267890
    Kingdom: Bacteria - Phylum: Proteobacteria - Class: Gammaproteobacteria - Order: Alteromonadales
    Bacteria; Proteobacteria; Gammaproteobacteria; Alteromonadales; Shewanellaceae;

Genomic Sequence

>JCVI_READ_378 GOS_1053020 Genomic DNA


[124 - 915/916]   direct strand
>GOS_1053020 Translation [124-915   direct strand]
[ Warning ] 3' incomplete: following codon is not a STOP

Annotator commentaries

La séquence GOS_1053020_Traduction_124-915_sens_direct est probablement incomplète. Elle code pour une protéine de synthèse des glucanes. Cette séquence appartient au génome d'une Shewanella, gammaproteobacteria. Elle semble très conservée chez les gamma proteobacteria et les enterobacteria.

La fonction moléculaire et le processus biologiques ont été déterminés grace à la fiche INTERPRO IPR007444.

ORF finding


Logiciel NCBI ORF Finder


ORF de 792pb sur le brin direct de la position 124 à la position 915.

L'ORF n'est pas complet, il n y a pas de codon stop en 3'.


    124 atgaaactggcgcgtaagctggcttctaagccctatgtggcgcta
        M  K  L  A  R  K  L  A  S  K  P  Y  V  A  L 
    169 aaggacccgctgccagcaggcctcgccaagttaacctacgatgaa
        K  D  P  L  P  A  G  L  A  K  L  T  Y  D  E 
    214 taccgcgacattcgctttaacccgatttcgtccatttggcgcgat
        Y  R  D  I  R  F  N  P  I  S  S  I  W  R  D 
    259 caaggtttaccatttcaaatgcaaatgtttcaccgtggcttctat
        Q  G  L  P  F  Q  M  Q  M  F  H  R  G  F  Y 
    304 ttccaagatttgatcgaaattgccatcgttgaagctaaccaatcg
        F  Q  D  L  I  E  I  A  I  V  E  A  N  Q  S 
    349 actcacttagcctacgagcctaagtatttcactgccggtgaagtt
        T  H  L  A  Y  E  P  K  Y  F  T  A  G  E  V 
    394 atcagccaagcattgccaaatgatgacattggttactcaggcttt
        I  S  Q  A  L  P  N  D  D  I  G  Y  S  G  F 
    439 cgcattcataaccagttaaacaccaacggtgtgtatgacgagctg
        R  I  H  N  Q  L  N  T  N  G  V  Y  D  E  L 
    484 atggtgttccaaggcgcgagttatttccgtgccttaggtaaaggt
        M  V  F  Q  G  A  S  Y  F  R  A  L  G  K  G 
    529 aactcctatggcttatctgcccgtggtttggcattaaaaaccgcc
        N  S  Y  G  L  S  A  R  G  L  A  L  K  T  A 
    574 gatccagaaggggaagagttccctattttccgtgcattttgggtt
        D  P  E  G  E  E  F  P  I  F  R  A  F  W  V 
    619 gaacgtccttcctacgacagcaacctgatcgtggtgcatgcactg
        E  R  P  S  Y  D  S  N  L  I  V  V  H  A  L 
    664 ctggatagcccaagtgttgcgggcgcgtatcgcttctctgtgcgt
        L  D  S  P  S  V  A  G  A  Y  R  F  S  V  R 
    709 cctggtgacaacacccagatcgacgtcgaagcgaccttattccct
        P  G  D  N  T  Q  I  D  V  E  A  T  L  F  P 
    754 cgcgtcgaactcagcaaagtcggtctagctcctagcactagcatg
        R  V  E  L  S  K  V  G  L  A  P  S  T  S  M 
    799 tttttacattcacttaatggccgccacgataccgacgactttaga
        F  L  H  S  L  N  G  R  H  D  T  D  D  F  R 
    844 cctgaagttcacgattcagacggtttgttaatgtttaacggccgt
        P  E  V  H  D  S  D  G  L  L  M  F  N  G  R 
    889 ggtgagcacctgtggcgtccactggcg 915    
        G  E  H  L  W  R  P  L  A 

Plusieurs cadres de lecture sont proposés. Celui ci Dessus est le plus long
Frame		from		to	Length
+1		124	..	915	792
-3		630	..	797	168
-1		395	..	562	168
+2		656	..	781	126
+2		209	..	316	108

Multiple Alignement


ClustalW site du PBIL


La sequence GOS présente une identitée quasi totale avec les Shewanella. L'ajout de séquences d'entérobactéries diminue la qualité de l'alignement.

On observe 46% d'identités entre la séquence inconnue et les séquences de shewanella. La seule différences notables étant la petite taille de la protéine qui semble tronquée sur 77 aminés en 5'. La très bonne conservation sur toute la longueur permet la conservation du domaine protéique "Glucan biosynthesis, periplasmic, MdoG C-terminal".

Sélection des séquences:

Les séquences de l'alignement multiple ont été sélectionnées parmi les E-values significatives dans les résultats du Blast-p. Les séquences présentant le plus d'identité (séquences de shewanella) ont été sélectionnées ainsi que les séquences de l'autre classe majoritairement représentée: les entérobactéries.


                       10        20        30        40        50        60
                        |         |         |         |         |         |
GOS_1053020    ------------------------------------------------------------
Enterobacter   ---------------------------MNRRRFLQGSLAMAALSGTTGLSTLFSRAAFAA
Salmonella     -------------------------------------------------MMKMRWLGAAI
Escherichia    -------------------------------------------------MMKMRWLSAAV
Pseudomonas    ------------------------------------------------------------

                       70        80        90       100       110       120
                        |         |         |         |         |         |
Pseudomonas    ------------------------------------------------------------

                      130       140       150       160       170       180
                        |         |         |         |         |         |
Pseudomonas    ------------------------------------------------------------

                      190       200       210       220       230       240
                        |         |         |         |         |         |
Pseudomonas    ------------------------------------------------------------

                      250       260       270       280       290       300
                        |         |         |         |         |         |
Pseudomonas    -----------------------------------------------------------K

                      310       320       330       340       350       360
                        |         |         |         |         |         |
               :*::* ****  . *        : ::***. * :  ..** : ***             

                      370       380       390       400       410       420
                        |         |         |         |         |         |
GOS_1053020    ------------------------------------------------------------

                      430       440       450       460       470       480
                        |         |         |         |         |         |
GOS_1053020    ------------------------------------------------------------

                      490       500       510       520       530       540
                        |         |         |         |         |         |
GOS_1053020    ------------------------------------------------------------

                      550       560       570       580       590       600
                        |         |         |         |         |         |
GOS_1053020    ------------------------------------------------------------
Shewanella     -DKELIELRA--------------ELKFST------------------------------
Shewanella_3   -DKDLIELRA--------------ELKFST------------------------------
Enterobacter   DSTDPIDMRM--------------FLRCQG------------------------------
Salmonella     DAKKTTEMRA--------------ALVNAD------------------------------
Escherichia    DAKKTTEMRA--------------ALVNAD------------------------------

                      610       620       630       640       650       660
                        |         |         |         |         |         |
GOS_1053020    ------------------------------------------------------------
Shewanella     ------------------------------------------------------------
Shewanella_3   ------------------------------------------------------------
Enterobacter   ------------------------------------------------------------
Salmonella     ------------------------------------------------------------
Escherichia    ------------------------------------------------------------

                      670       680       690       700
                        |         |         |         |
GOS_1053020    ----------------------------------------
Shewanella     ------------PRQVETWLYRWTL---------------
Shewanella_3   ------------PRQVETWLYRWTL---------------
Salmonella     ------------QTLSETWSYQLPANE-------------
Escherichia    ------------QTLSETWSYQLPANE-------------
Prim.cons.     AAPTHPEPAKTLQ22SETW2YQLP2NEPDKRVYVDDRVMR                    

Alignment data :
Alignment length : 700
Identity (*) : 16 is 2.29 %
Strongly similar (:) : 9 is 1.29 %
Weakly similar (.) : 4 is 0.57 %
Different : 671 is 95.86 %
Sequence 0001 : GOS_1053020 ( 264 residues).
Sequence 0002 : Shewanella ( 545 residues).
Sequence 0003 : Shewanella_3 ( 544 residues).
Sequence 0004 : Enterobacter ( 551 residues).
Sequence 0005 : Salmonella ( 511 residues).
Sequence 0006 : Escherichia ( 511 residues).
Sequence 0007 : Pseudomonas ( 384 residues).


                       10        20        30        40        50        60
                        |         |         |         |         |         |
GOS_1053020    ------------------------------------------------------------

                       70        80        90       100       110       120
                        |         |         |         |         |         |

                      130       140       150       160       170       180
                        |         |         |         |         |         |

                      190       200       210       220       230       240
                        |         |         |         |         |         |

                      250       260       270       280       290       300
                        |         |         |         |         |         |

                      310       320       330       340       350       360
                        |         |         |         |         |         |

                      370       380       390       400       410       420
                        |         |         |         |         |         |
GOS_1053020    ------------------------------------------------------------

                      430       440       450       460       470       480
                        |         |         |         |         |         |
GOS_1053020    ------------------------------------------------------------

                      490       500       510       520       530       540
                        |         |         |         |         |         |
GOS_1053020    ------------------------------------------------------------

GOS_1053020    -----
Shewanella     YRWTL
Shewanella_3   YRWTL
Prim.cons.     YRWTL                                                       

Alignment data :
Alignment length : 545
Identity (*) : 256 is 46.97 %
Strongly similar (:) : 7 is 1.28 %
Weakly similar (.) : 1 is 0.18 %
Different : 281 is 51.56 %
Sequence 0001 : GOS_1053020 ( 264 residues).
Sequence 0002 : Shewanella ( 545 residues).
Sequence 0003 : Shewanella_3 ( 544 residues).

Protein Domains




Domaine spécifique de la synthèse des glucanes identifié avec une E-value significatives 2.5e-171.


Glucan biosynthesis, periplasmic, MdoG C-terminal
PFAM 	PF04349 	MdoG 	2.5e-171 [2-264]T
Parent 	no parent
Children 	no children
Found in 	IPR014438
Contains 	IPR011013 IPR014756
GO terms 	Biological Process: carbohydrate biosynthetic process (GO:0016051)
Cellular Component: periplasmic space (GO:0042597)
Glycoside hydrolase-type carbohydrate-binding
SUPERFAMILY 	SSF74650 	Galactose mutarotase-like 	3.2e-105 [1-264]T
Parent 	no parent
Children 	IPR005196 IPR011682 IPR014718 IPR015179 IPR015364
Found in 	IPR000165 IPR007444 IPR014438
Contains 	IPR009342 IPR010383 IPR010403 IPR018052
GO terms 	Molecular Function: catalytic activity (GO:0003824)
Biological Process: carbohydrate metabolic process (GO:0005975)
Molecular Function: carbohydrate binding (GO:0030246) 




La sequence GOS_1053020_Traduction_124-915_sens_direct se retrouve au m:ilieu de l'arbre des shewanela alors que les enterobactéries sont à l'écart. La séquence inconnue est donc probablement une gamma-proteobacterie qui fait partie des shewanella.


  |                            |   +Salmonella_enterica_subsp._enterica_serovar_Paratyphi_A._gi_8136
  |                            +---+
  |                                +------------------Pseudomonas_syringae_pv._syringae._gi_32470594_sp_P20400.2_Gluca
 ||                                                    +Shewanella sp ANA-3 Glucans Biosynthesis protein
 ||                                                    |
 ||                                                    |
 ||                                                    |GOS_1053020_Traduction_124-915_sens_direct
 |                                                     |
 |                                                     +Shewanella oneidensis Glucans biosynthesis protein

Taxonomy report



Tous les résultats de BLAST qui présentent une E-value significative appartiennent à la famille des gamma-proteobactéries.

cellular organisms
. Proteobacteria      [proteobacteria]
. . Gammaproteobacteria [g-proteobacteria]
. . . Shewanella          [g-proteobacteria]
. . . . Shewanella sp. ANA-3 -------------------------------------------------  544 1 hit  [g-proteobacteria]  RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . . Shewanella sp. MR-4 ..................................................  541 1 hit  [g-proteobacteria]  RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . . Shewanella sp. MR-7 ..................................................  541 1 hit  [g-proteobacteria]  RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . . Shewanella oneidensis ................................................  540 3 hits [g-proteobacteria]  RecName: Full=Glucans biosynthesis protein G 1; Flags: Prec
. . . . Shewanella putrefaciens CN-32 ........................................  525 1 hit  [g-proteobacteria]  RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . . Shewanella sp. W3-18-1 ...............................................  525 1 hit  [g-proteobacteria]  RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . . Shewanella baltica OS195 .............................................  510 1 hit  [g-proteobacteria]  RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . . Shewanella baltica OS223 .............................................  510 1 hit  [g-proteobacteria]  RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . . Shewanella baltica OS155 .............................................  509 1 hit  [g-proteobacteria]  RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . . Shewanella baltica OS185 .............................................  509 1 hit  [g-proteobacteria]  RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . . Shewanella frigidimarina NCIMB 400 ...................................  447 1 hit  [g-proteobacteria]  RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Vibrio cholerae --------------------------------------------------------  442 1 hit  [g-proteobacteria]  RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Vibrio cholerae O395 ...................................................  442 1 hit  [g-proteobacteria]  RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Vibrio cholerae M66-2 ..................................................  442 1 hit  [g-proteobacteria]  RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Salmonella enterica subsp. enterica serovar Paratyphi A ................  234 2 hits [enterobacteria]    RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Salmonella enterica subsp. enterica serovar Paratyphi A str. AKU_12601 .  234 2 hits [enterobacteria]    RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Klebsiella pneumoniae 342 ..............................................  234 2 hits [enterobacteria]    RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Pectobacterium carotovorum subsp. carotovorum PC1 ......................  233 1 hit  [enterobacteria]    RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Erwinia chrysanthemi str. 3937 .........................................  232 1 hit  [enterobacteria]    RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Salmonella enterica subsp. enterica serovar Typhi ......................  231 2 hits [enterobacteria]    RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Salmonella enterica subsp. enterica serovar Typhimurium ................  231 2 hits [enterobacteria]    RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Salmonella enterica subsp. enterica serovar Enteritidis str. P125109 ...  231 2 hits [enterobacteria]    RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Salmonella enterica subsp. enterica serovar Gallinarum str. 287/91 .....  231 2 hits [enterobacteria]    RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Escherichia coli IAI1 ..................................................  231 1 hit  [enterobacteria]    RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Escherichia fergusonii ATCC 35469 ......................................  231 1 hit  [enterobacteria]    RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Escherichia coli O157:H7 ...............................................  231 2 hits [enterobacteria]    RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Escherichia coli O6 ....................................................  231 2 hits [enterobacteria]    RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Escherichia coli 536 ...................................................  231 1 hit  [enterobacteria]    RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Shigella sonnei Ss046 ..................................................  231 2 hits [enterobacteria]    RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Escherichia coli E24377A ...............................................  231 2 hits [enterobacteria]    RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Escherichia coli HS ....................................................  231 2 hits [enterobacteria]    RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Escherichia coli ATCC 8739 .............................................  231 1 hit  [enterobacteria]    RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Escherichia coli S88 ...................................................  231 1 hit  [enterobacteria]    RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Escherichia coli IAI39 .................................................  231 1 hit  [enterobacteria]    RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Escherichia coli UMN026 ................................................  231 1 hit  [enterobacteria]    RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Escherichia coli SE11 ..................................................  231 2 hits [enterobacteria]    RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Shigella boydii CDC 3083-94 ............................................  231 2 hits [enterobacteria]    RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Escherichia coli O127:H6 str. E2348/69 .................................  231 2 hits [enterobacteria]    RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Escherichia coli 55989 .................................................  231 1 hit  [enterobacteria]    RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Escherichia coli ED1a ..................................................  231 1 hit  [enterobacteria]    RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Escherichia coli UTI89 .................................................  230 2 hits [enterobacteria]    RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Escherichia coli APEC O1 ...............................................  230 2 hits [enterobacteria]    RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Escherichia coli O157:H7 str. EC4115 ...................................  230 1 hit  [enterobacteria]    RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Escherichia coli SMS-3-5 ...............................................  230 1 hit  [enterobacteria]    RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Shigella flexneri ......................................................  230 2 hits [enterobacteria]    RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Shigella dysenteriae Sd197 .............................................  230 2 hits [enterobacteria]    RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Pectobacterium atrosepticum ............................................  229 1 hit  [enterobacteria]    RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Escherichia coli K-12 ..................................................  229 2 hits [enterobacteria]    RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Escherichia coli str. K-12 substr. DH10B ...............................  229 2 hits [enterobacteria]    RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Escherichia coli BW2952 ................................................  229 2 hits [enterobacteria]    RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Serratia proteamaculans 568 ............................................  228 1 hit  [enterobacteria]    RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Shigella boydii Sb227 ..................................................  228 2 hits [enterobacteria]    RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Pseudomonas entomophila L48 ............................................  226 1 hit  [g-proteobacteria]  RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Pseudomonas aeruginosa PA7 .............................................  225 1 hit  [g-proteobacteria]  RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Pseudomonas aeruginosa .................................................  225 1 hit  [g-proteobacteria]  RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Pseudomonas aeruginosa UCBPP-PA14 ......................................  225 1 hit  [g-proteobacteria]  RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Pseudomonas aeruginosa LESB58 ..........................................  225 1 hit  [g-proteobacteria]  RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Pseudomonas putida KT2440 ..............................................  221 1 hit  [g-proteobacteria]  RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Pseudomonas putida W619 ................................................  220 1 hit  [g-proteobacteria]  RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Xanthomonas oryzae pv. oryzae PXO99A ...................................  219 1 hit  [g-proteobacteria]  RecName: Full=Glucans biosynthesis protein D; Flags: Precur
. . . Xanthomonas oryzae pv. oryzae ..........................................  219 1 hit  [g-proteobacteria]  RecName: Full=Glucans biosynthesis protein D; Flags: Precur
. . . Xylella fastidiosa M12 .................................................  218 1 hit  [g-proteobacteria]  RecName: Full=Glucans biosynthesis protein D; Flags: Precur
. . . Xylella fastidiosa .....................................................  218 1 hit  [g-proteobacteria]  RecName: Full=Glucans biosynthesis protein D; Flags: Precur
. . . Sodalis glossinidius str. 'morsitans' ..................................  218 1 hit  [enterobacteria]    RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Pseudomonas syringae pv. tomato ........................................  218 2 hits [g-proteobacteria]  RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . . Xanthomonas campestris pv. campestris ..................................  217 1 hit  [g-proteobacteria]  RecName: Full=Glucans biosynthesis protein D; Flags: Precur
. . . Xanthomonas campestris pv. campestris str. 8004 ........................  216 1 hit  [g-proteobacteria]  RecName: Full=Glucans biosynthesis protein D; Flags: Precur
. . . Xanthomonas campestris pv. campestris str. B100 ........................  216 1 hit  [g-proteobacteria]  RecName: Full=Glucans biosynthesis protein D; Flags: Precur
. . . Xanthomonas axonopodis pv. citri .......................................  216 1 hit  [g-proteobacteria]  RecName: Full=Glucans biosynthesis protein D; Flags: Precur
. . . Xylella fastidiosa M23 .................................................  216 1 hit  [g-proteobacteria]  RecName: Full=Glucans biosynthesis protein D; Flags: Precur
. . . Xylella fastidiosa Temecula1 ...........................................  216 1 hit  [g-proteobacteria]  RecName: Full=Glucans biosynthesis protein D; Flags: Precur
. . . Stenotrophomonas maltophilia K279a .....................................  214 1 hit  [g-proteobacteria]  RecName: Full=Glucans biosynthesis protein D; Flags: Precur
. . . Stenotrophomonas maltophilia R551-3 ....................................  214 1 hit  [g-proteobacteria]  RecName: Full=Glucans biosynthesis protein D; Flags: Precur
. . . Cronobacter sakazakii ATCC BAA-894 .....................................  171 1 hit  [enterobacteria]    RecName: Full=Glucans biosynthesis protein D; Flags: Precur
. . . Pseudomonas fluorescens Pf-5 ...........................................  169 1 hit  [g-proteobacteria]  RecName: Full=Glucans biosynthesis protein D; Flags: Precur
. . . Pseudomonas syringae pv. syringae B728a ................................  169 1 hit  [g-proteobacteria]  RecName: Full=Glucans biosynthesis protein D; Flags: Precur
. . . Pseudomonas syringae pv. phaseolicola 1448A ............................  164 1 hit  [g-proteobacteria]  RecName: Full=Glucans biosynthesis protein D; Flags: Precur
. . . Pseudomonas fluorescens Pf0-1 ..........................................  162 1 hit  [g-proteobacteria]  RecName: Full=Glucans biosynthesis protein D; Flags: Precur
. . . Pseudomonas fluorescens SBW25 ..........................................  157 1 hit  [g-proteobacteria]  RecName: Full=Glucans biosynthesis protein D; Flags: Precur
. . . Enterobacter sp. 638 ...................................................  154 1 hit  [enterobacteria]    RecName: Full=Glucans biosynthesis protein D; Flags: Precur
. . . Pseudomonas syringae pv. syringae ......................................   49 1 hit  [g-proteobacteria]  RecName: Full=Glucans biosynthesis protein G
. . . Edwardsiella ictaluri 93-146 ...........................................   32 1 hit  [enterobacteria]    RecName: Full=Mannonate dehydratase; AltName: Full=D-mannon
. . Bradyrhizobium japonicum -------------------------------------------------  300 1 hit  [a-proteobacteria]  RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . Rhodopseudomonas palustris BisA53 ........................................  294 1 hit  [a-proteobacteria]  RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . Rhodopseudomonas palustris ...............................................  292 1 hit  [a-proteobacteria]  RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . Ralstonia solanacearum ...................................................  250 4 hits [b-proteobacteria]  RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . Nitrosomonas europaea ....................................................  221 1 hit  [b-proteobacteria]  RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . Rhodobacter sphaeroides 2.4.1 ............................................  197 1 hit  [a-proteobacteria]  RecName: Full=Glucans biosynthesis protein G; Flags: Precur
. . Ralstonia metallidurans CH34 .............................................   34 1 hit  [b-proteobacteria]  RecName: Full=Methionine import ATP-binding protein metN
. . Ralstonia eutropha H16 ...................................................   33 1 hit  [b-proteobacteria]  RecName: Full=Methionine import ATP-binding protein metN
. . Ralstonia eutropha JMP134 ................................................   33 1 hit  [b-proteobacteria]  RecName: Full=Methionine import ATP-binding protein metN
. Gallus gallus (bantam) -----------------------------------------------------   33 1 hit  [birds]             RecName: Full=Ras-responsive element-binding protein 1; Sho
. Homo sapiens (man) .........................................................   31 1 hit  [primates]          RecName: Full=Vomeronasal type-1 receptor 2; AltName: Full=




81 résultats lors du Blast-p contre SWISSPROT dont 74 avec des E-values significatives.

Toutes les E-values significatives appartiennent à la famille des gamma-proteobactéries. Et correspondent à des gènes qui codent pour la biosynthèse de glucans periplasmiques.

La methionine est alignée sur le codon 78 des protéines trouvées. Il manque les 77premiers acides aminés de la sequence GOS_1053020 ADN génomique (Sargasso Sea: Sargasso Sea, Station 11).


Blast-p contre la banque de données SWISSPROT
                                                                   Score     E
Sequences producing significant alignments:                       (Bits)  Value

sp|A0KWE9.1|OPGG_SHESA  RecName: Full=Glucans biosynthesis pro...   544    2e-154 Gene info
sp|Q0HJ64.1|OPGG_SHESM  RecName: Full=Glucans biosynthesis pro...   541    2e-153 Gene info
sp|Q0HUR9.1|OPGG_SHESR  RecName: Full=Glucans biosynthesis pro...   541    2e-153 Gene info
sp|Q8EF79.2|OPGG1_SHEON  RecName: Full=Glucans biosynthesis pr...   540    3e-153
sp|A4Y769.1|OPGG_SHEPC  RecName: Full=Glucans biosynthesis pro...   525    1e-148 Gene info
sp|A9KZ12.1|OPGG_SHEB9  RecName: Full=Glucans biosynthesis pro...   510    4e-144 Gene info
sp|A3D3T9.1|OPGG_SHEB5  RecName: Full=Glucans biosynthesis pro...   509    5e-144 Gene info
sp|Q07WE1.1|OPGG_SHEFN  RecName: Full=Glucans biosynthesis pro...   447    3e-125 Gene info
sp|Q9KSG8.1|OPGG_VIBCH  RecName: Full=Glucans biosynthesis pro...   442    7e-124
sp|Q89BU4.2|OPGG_BRAJA  RecName: Full=Glucans biosynthesis pro...   300    7e-81 
sp|Q07T76.1|OPGG_RHOP5  RecName: Full=Glucans biosynthesis pro...   294    4e-79  Gene info
sp|Q6N5U4.1|OPGG_RHOPA  RecName: Full=Glucans biosynthesis pro...   292    2e-78 
sp|Q8XVC3.1|OPGG_RALSO  RecName: Full=Glucans biosynthesis pro...   250    7e-66 
sp|Q5PGX6.1|OPGG_SALPA  RecName: Full=Glucans biosynthesis pro...   234    4e-61 
sp|B5XXK6.1|OPGG_KLEP3  RecName: Full=Glucans biosynthesis pro...   234    5e-61  Gene info
sp|C6DKV3.1|OPGG_PECCP  RecName: Full=Glucans biosynthesis pro...   233    1e-60 
sp|Q9F496.1|OPGG_DICD3  RecName: Full=Glucans biosynthesis pro...   232    2e-60 
sp|P67558.1|OPGG_SALTI  RecName: Full=Glucans biosynthesis pro...   231    3e-60 
sp|B7M924.1|OPGG_ECO8A  RecName: Full=Glucans biosynthesis pro...   231    3e-60  Gene info
sp|B7LT86.1|OPGG_ESCF3  RecName: Full=Glucans biosynthesis pro...   231    4e-60  Gene info
sp|Q8EDL2.1|OPGG2_SHEON  RecName: Full=Glucans biosynthesis pr...   231    4e-60 
sp|P67556.1|OPGG_ECO57  RecName: Full=Glucans biosynthesis pro...   231    5e-60 
sp|Q1RDB0.1|OPGG_ECOUT  RecName: Full=Glucans biosynthesis pro...   230    5e-60  Gene info
sp|Q83RU3.2|OPGG_SHIFL  RecName: Full=Glucans biosynthesis pro...   230    5e-60 
sp|Q32E76.1|OPGG_SHIDS  RecName: Full=Glucans biosynthesis pro...   230    6e-60  Gene info
sp|Q6D6A8.1|OPGG_ERWCT  RecName: Full=Glucans biosynthesis pro...   229    1e-59 
sp|P33136.1|OPGG_ECOLI  RecName: Full=Glucans biosynthesis pro...   229    1e-59 
sp|A8GCY3.1|OPGG_SERP5  RecName: Full=Glucans biosynthesis pro...   228    2e-59  Gene info
sp|Q31ZA4.1|OPGG_SHIBS  RecName: Full=Glucans biosynthesis pro...   228    2e-59  Gene info
sp|Q8EI02.2|OPGD_SHEON  RecName: Full=Probable glucans biosynt...   228    2e-59 
sp|Q1I3R5.1|OPGG_PSEE4  RecName: Full=Glucans biosynthesis pro...   226    2e-58  Gene info
sp|A6VDK1.1|OPGG_PSEA7  RecName: Full=Glucans biosynthesis pro...   225    2e-58  Gene info
sp|Q9HUA5.1|OPGG_PSEAE  RecName: Full=Glucans biosynthesis pro...   225    2e-58 
sp|Q88D03.1|OPGG_PSEPK  RecName: Full=Glucans biosynthesis pro...   221    2e-57  Gene info
sp|Q82SA9.2|OPGG_NITEU  RecName: Full=Glucans biosynthesis pro...   221    3e-57 
sp|B1J2R3.1|OPGG_PSEPW  RecName: Full=Glucans biosynthesis pro...   220    6e-57  Gene info
sp|B2SHI0.1|OPGD_XANOP  RecName: Full=Glucans biosynthesis pro...   219    2e-56  Gene info
sp|Q5H6C7.1|OPGD_XANOR  RecName: Full=Glucans biosynthesis pro...   219    2e-56 
sp|B0U613.1|OPGD_XYLFM  RecName: Full=Glucans biosynthesis pro...   218    3e-56  Gene info
sp|Q9PA38.1|OPGD_XYLFA  RecName: Full=Glucans biosynthesis pro...   218    3e-56 
sp|Q2NU55.1|OPGG_SODGM  RecName: Full=Glucans biosynthesis pro...   218    4e-56  Gene info
sp|Q87UY0.1|OPGG_PSESM  RecName: Full=Glucans biosynthesis pro...   218    4e-56 
sp|Q8P3C6.1|OPGD_XANCP  RecName: Full=Glucans biosynthesis pro...   217    7e-56 
sp|Q4UNU8.1|OPGD_XANC8  RecName: Full=Glucans biosynthesis pro...   216    8e-56  Gene info
sp|Q8PEQ6.1|OPGD_XANAC  RecName: Full=Glucans biosynthesis pro...   216    1e-55 
sp|B2IAA4.1|OPGD_XYLF2  RecName: Full=Glucans biosynthesis pro...   216    1e-55 
sp|Q879Z7.1|OPGD_XYLFT  RecName: Full=Glucans biosynthesis pro...   216    1e-55  Gene info
sp|B2FU50.1|OPGD_STRMK  RecName: Full=Glucans biosynthesis pro...   214    4e-55 
sp|B4SRN1.1|OPGD_STRM5  RecName: Full=Glucans biosynthesis pro...   214    5e-55 
sp|Q8XUX6.2|OPGD1_RALSO  RecName: Full=Glucans biosynthesis pr...   213    1e-54 
sp|Q9FA54.1|OPGG_RHOS4  RecName: Full=Glucans biosynthesis pro...   197    7e-50  Gene info
sp|Q8XT53.2|OPGD2_RALSO  RecName: Full=Glucans biosynthesis pr...   172    2e-42 
sp|A7MLE5.1|OPGD_ENTS8  RecName: Full=Glucans biosynthesis pro...   171    4e-42  Gene info
sp|Q4KHN0.1|OPGD_PSEF5  RecName: Full=Glucans biosynthesis pro...   169    1e-41  Gene info
sp|Q4ZL60.1|OPGD_PSEU2  RecName: Full=Glucans biosynthesis pro...   169    2e-41  Gene info
sp|B5XWS2.1|OPGD_KLEP3  RecName: Full=Glucans biosynthesis pro...   166    1e-40  Gene info
sp|Q87TX5.1|OPGD_PSESM  RecName: Full=Glucans biosynthesis pro...   166    2e-40 
sp|Q5PHT4.1|OPGD_SALPA  RecName: Full=Glucans biosynthesis pro...   166    2e-40 
sp|Q8Z765.2|OPGD_SALTI  RecName: Full=Glucans biosynthesis pro...   165    2e-40 
sp|Q48BK0.1|OPGD_PSE14  RecName: Full=Glucans biosynthesis pro...   164    4e-40  Gene info
sp|B5R535.1|OPGD_SALEP  RecName: Full=Glucans biosynthesis pro...   164    4e-40  Gene info
sp|Q8ZPB3.1|OPGD_SALTY  RecName: Full=Glucans biosynthesis pro...   164    4e-40 
sp|Q3KHH5.1|OPGD_PSEPF  RecName: Full=Glucans biosynthesis pro...   162    2e-39  Gene info
sp|Q8CW34.1|OPGD_ECOL6  RecName: Full=Glucans biosynthesis pro...   162    2e-39 
sp|B7URH4.1|OPGD_ECO27  RecName: Full=Glucans biosynthesis pro...   162    3e-39 
sp|P40120.3|OPGD_ECOLI  RecName: Full=Glucans biosynthesis pro...   160    9e-39 
sp|B2U143.1|OPGD_SHIB3  RecName: Full=Glucans biosynthesis pro...   160    9e-39  Gene info
sp|Q8X9V1.1|OPGD_ECO57  RecName: Full=Glucans biosynthesis pro...   160    1e-38 
sp|A7ZZY2.1|OPGD_ECOHS  RecName: Full=Glucans biosynthesis pro...   159    1e-38  Gene info
sp|Q32FN2.1|OPGD_SHIDS  RecName: Full=Glucans biosynthesis pro...   159    1e-38  Gene info
sp|Q83R85.1|OPGD_SHIFL  RecName: Full=Glucans biosynthesis pro...   159    2e-38 
sp|C3KDR8.1|OPGD_PSEFS  RecName: Full=Glucans biosynthesis pro...   157    9e-38 
sp|A4WAB7.1|OPGD_ENT38  RecName: Full=Glucans biosynthesis pro...   154    5e-37  Gene info
sp|P20400.2|OPGG_PSESY  RecName: Full=Glucans biosynthesis pro...  49.7    2e-05 
sp|Q1LQF6.1|METN_RALME  RecName: Full=Methionine import ATP-bi...  34.3    0.83   Gene info
sp|O57415.2|RREB1_CHICK  RecName: Full=Ras-responsive element-...  33.9    0.99   Gene info
sp|Q0KDG3.1|METN_RALEH  RecName: Full=Methionine import ATP-bi...  33.1    1.8    Gene info
sp|Q46Y69.1|METN_RALEJ  RecName: Full=Methionine import ATP-bi...  33.1    1.8    Gene info
sp|Q8Y0X3.1|METN_RALSO  RecName: Full=Methionine import ATP-bi...  32.3    2.8   
sp|C5BG25.1|UXUA_EDWI9  RecName: Full=Mannonate dehydratase; A...  32.3    3.1   
sp|Q8NFZ6.2|VN1R2_HUMAN  RecName: Full=Vomeronasal type-1 rece...  31.6    5.1    Gene info

Personal tools