GOS 1048080

From Metagenes
Warning: this metagenomic sequence has been carefully annotated by students during bioinformatics assignments. These quality annotations are therefore the result of a teaching exercise that you are most welcome to amend and extend if necessary!

CAMERA AccNum : JCVI_READ_1093017708087
Annotathon code: GOS_1048080
Sample :
  • GPS :4°29'56s; 105°04'12w
  • Tropical South Pacific: Tropical South Pacific - International
  • Open Ocean (-2.2m, 27.8°C, 0.1-0.8 microns)
Team : Orsay 2009
Username : mmonsoo
Annotated on : 2010-01-18 23:48:53
  • Monsoor Misharl


  • Taxonomy: Cyanobacteria (NCBI info)
    Rank: phylum - Genetic Code: Bacterial and Plant Plastid - NCBI Identifier: 1117
    Kingdom: Bacteria - Phylum: Cyanobacteria - Class: - Order:
    Bacteria; Cyanobacteria;

Genomic Sequence

>JCVI_READ_1093017708087 GOS_1048080 Genomic DNA


[71 - 868/987]   direct strand
>GOS_1048080 Translation [71-868   direct strand]

Annotator commentaries

Pour conclure, cette séquence inconnue semble posséder un domaine Aminotransferase de type class IV,

(De la position 71 à 868 avec une E-value significative de 2e-57 (PFAM). Cette observation nous

informe que cette séquence est codante et que la protéine a une fonction liée aux transaminases.

D'après Blastp contre suisse prot, les meilleurs hits trouvés correspondent aux taxons suivants:

Cyanobacterie(Groupe d'étude) et Groupe exterieur (Aquificales,spirochetes,GNS

bacteria,proteobacteria,archaea,euryarchaeotes,green sulfur bacteria et high GC Gram+).

L'alignement multiple au format Clustal appuie les résultats du domaine proteique trouvé par PFAM et

Prosite car il ya une région très conservée dans l'alignement allant de 181 à 300. Cette region

(181 à 300) contient bien le motif conservé (EaSgmNLFivrdgd......LiTpgvdqdi.LeGItR) qui signale la presence

d'un domaine Aminotransferase de type IV.

D'après l'arbre phylogénétique construit à partir de phylogenie.fr, cette sequence inconnue a un lien de

parenté très fort avec les Cyanobacteries ce qui est corroborée avec Blast ( Nombre de hits très élevées

et E-value très petites d'ordre e-100 concernant les Cyanobacteries).

ORF finding



L'ORF le plus long trouvé sur le brin direct (Cadre de lecture +2) de la position 71 à la position 871.


     71 atgagggcaatacctaatccatctgataagaatgaatttctttta
        M  R  A  I  P  N  P  S  D  K  N  E  F  L  L 
    116 tttagaacagacaagcatattaaaagacttactcaaagtgcaaaa
        F  R  T  D  K  H  I  K  R  L  T  Q  S  A  K 
    161 tttcttctgactgaattaaaagaagattatgtttataatgccttg
        F  L  L  T  E  L  K  E  D  Y  V  Y  N  A  L 
    206 gaaaagattattaaaataaataaacctgataaaccaatttatata
        E  K  I  I  K  I  N  K  P  D  K  P  I  Y  I 
    251 agaccatttgtctatacaagtgatttaggtattgctccaagatta
        R  P  F  V  Y  T  S  D  L  G  I  A  P  R  L 
    296 cataatattgagacaaatttctttatttattgtatagaacttggc
        H  N  I  E  T  N  F  F  I  Y  C  I  E  L  G 
    341 gattatctttctccggatggtgttacatgtcgcatgagtagttgg
        D  Y  L  S  P  D  G  V  T  C  R  M  S  S  W 
    386 tcaagacaggaagatagatctcttcctttaagaggaaagattagt
        S  R  Q  E  D  R  S  L  P  L  R  G  K  I  S 
    431 ggtgcatacataacaagctcattagcaaaaacagaagcaagtcta
        G  A  Y  I  T  S  S  L  A  K  T  E  A  S  L 
    476 tctggttttgatgaggcattgctattaaattctagaggtaaagtt
        S  G  F  D  E  A  L  L  L  N  S  R  G  K  V 
    521 agtgaagctagtggtatgaatttatttatagttagagatggtgat
        S  E  A  S  G  M  N  L  F  I  V  R  D  G  D 
    566 ttaataactcctggagttgatcaagatattcttgaaggtataact
        L  I  T  P  G  V  D  Q  D  I  L  E  G  I  T 
    611 agagctagtgttatagaaatagcaagatctatgggattaaatgta
        R  A  S  V  I  E  I  A  R  S  M  G  L  N  V 
    656 attgaaagacccgtagataaaactgaattatttattgctgatgaa
        I  E  R  P  V  D  K  T  E  L  F  I  A  D  E 
    701 gtcttcttaacaggaactgctgcaaagataactccaataaaacaa
        V  F  L  T  G  T  A  A  K  I  T  P  I  K  Q 
    746 atagagtcaaccaaattagtaggagatagaacaataatgaaaaaa
        I  E  S  T  K  L  V  G  D  R  T  I  M  K  K 
    791 ttaaaatctaagctaatagaaataacagaaggacgatcaaaagac
        L  K  S  K  L  I  E  I  T  E  G  R  S  K  D 
    836 tatgatagttgggttacacgaatcaaaattaactaa 871    
        Y  D  S  W  V  T  R  I  K  I  N  * 

Frame		from		to	Length
+2		71	..	871	801
+1		880	..	986	108

Multiple Alignement

PROTOCOLE: One click Mode phylo.fr


On observe que la sequence Gos inconnue ne s'aligne pas avec les autres séquences sur 63 codons.

Cela ne veut pas dire forcement que cette séquence soit tronquée de la position 1 à 63 car

si on observe l'alignement, on observe aussi d'autres séquences qui ne s'alignent du tout

au debut de la sequence avec beaucoup de gaps.

On observe aussi qu'il ya une région très conservée allant de 181 à 300 dans l'alignement. Cette region

(181 à 300) contient bien le motif conservé (EaSgmNLFivrdgd......LiTpgvdqdi.LeGItR)

predit par PROSITE de 152 à 181, ce qui correspond bien au domaine prédit par PROSITE et PFAM.

L'alignement multiple effectué par PHYLOGENIE.FR corrobore les résultats concernant le domaine protéique


Resultats bruts:

CLUSTAL FORMAT: MUSCLE (3.7) multiple sequence alignment

mP3H9_arch      ------------------------MKFPLSKYIWFDGKLVPVNMAKVPVTTHAIHYGTSI
m.cr.HF400      -------------------------------------------MAKVPVTTHAIHYGTSI
Ca.M.acidi      -------------------------MDKSNLKVWLNGKILDYGGAKVPILTHSLQYGSGI
Po.necessa      -----------------------MSMSDRDGFIWNDGKLIPWREANVHVLTHSLHYGMGV
Prs.ae.gre      --------------------------MNKSEKIWMNGELVNWHDAKIHILSHVIHYGSST
Se.Inconnu      ------------------------------------------------------------
PrcM.mu.cy      -------------------------MQEFLPYAWFEGKCIPFKDAKVSIATHSLHYGTAA
PrcsM30.mu      -------------------------MHEFLPYAWFEGKCIPFKEAKISIATHALHYGTAA
PrcsM2.mu.      -------------------------MHEFLPYAWFEGKCIPFKEAKISIATHALHYGTAA
PrcsA.mu.c      -------------------------MHEFLPYAWFEGKCIPFKEAKISIATHALHYGTAA
PrcsM31.mu      -------------------------MHEFLPYAWFEGKCIPFKEAKISIATHALHYGTAA
Pl.pa.SIR-      ------------------------------------------------------------
Cl.cellulo      ----------------------------MSTIAFYEGKFVDENDINISVRSKAFNYGLGC
Cl.n.NT_fi      ---------------------------MEKSYVFFDGKIMDEKDVNLSIRNKAFNYGLAC
L.bi1.sero      ------------------------MAQNSFPYTYFEGKIVPSEDAKVSVQTHALQYGTGV
L.bi2.sero      ------------------------MAQNSFPYTYFEGKIVPSEDAKVSVQTHALQYGTGV
L1.bo.sero      ------------------------------------------------------------
L2.bo.sero      ------------------------MAESIKKLSYFEGKILPESEAKISIQTHALQYGTTV
ChJ-10-fl       --------------------------MPNNRFAFFNGEIVPIEQAQVSVMTNALNYGTGC
Chloroflex      --------------------------MPNNRFAFFNGEIVPIEQAQVSVMTNALNYGTGC
Roseiflexu      --------------------------MSANRFAFFNGEFVPIEQAQVSVMTAALNYGLGV
Ro.ca.GNS       --------------------------MTSNRFAFFNGEFVPIEQAQVSVMTAALNYGLGV
Hydrogeniv      -----------------------------MEYAFFEGKFVPIEEANINIKTNSFHYGTAI
Pe.ma.EX-H      -----------------------------MEYIYFEGKIVPEDQAKISIKTNSFHYGTAI
Su.az.Az-F      -----------------------------MAIVYFENKFVEEEEAKISIKTNSFHYGTAV
SuY.aq.bra      -----------------------------MAIVYFENKFVPEEEAKISIKTNSFHYGTAV
Sulfurihyd      ------------------------------------------------------------

L1.bo.sero      -----------------------------------QLKLDKTKEELRDITIDLIRQCGYK
Sulfurihyd      --------------------------------------------QLVDITAQLVKVNNHK

                   *:**                       :                      *.: .  

                        *  . * .  :    .   .  :.: *   * :.*  .  ::    .   :.

                      * .:**     .        .  :  : .  :  ::* :: **  ::  : .::

                   :           :   :                            

Protein Domains

PROTOCOLE: Utilisation de Pfam HMM et Prosite individuellement ( Interproscan ne marchait pas)


PFAM HMM et Prosite ont trouvé un domaine Aminotransferases class-IV like.

Pour PFAM avec une E-Value significative 2e-57, allant de la position 6 à 246 et pour Prosite, un domaine

allant de 152 à 181. Les résultats de PFAM et Prosite ne sont pas en contradiction.



glocal	Aminotransferase class IV
Aminotran_4: domain 1 of 1, from 6 to 246: score 201.5, E = 2e-57
                      n+                               ++++  +lFR d+H
  GOS_104808     6    NP-------------------------------SDKNEFLLFRTDKH 21   

                   i+RL +SAk+l  ++   ++ + +al++ +k+N+ ++      +Yirp++

                   +++d+g+ ++ ++ +t+f i++ +  +y+     +gv +  s++ R++++

                   ++++++K++g Y+ s Lak eA   G  ++eaLll+++g+++E ++mN+F

                    v +g      l+TP +dq  +IL+GITR s++e+A++ G   ++v+Erp

                   +++ eL +AdE+f       +GTAA++tP+k I+         +++    

                     i kkL+++l    
  GOS_104808   236 -TIMKKLKSKLI    246  


Hits by PS00770   AA_TRANSFER_CLASS_4   Aminotransferases class-IV signature  :
GOS_1048080	GOS_1048080 hits	    (266 aa)

152 - 181: 	  EaSgmNLFivrdgd......LiTpgvdqdi.LeGItR


PROTOCOLE: One click Mode phylo.fr


D'après cette arbre, ces sequences semble être orthologues entre elles car elles possedent la même fonction

(branched-chain-amino-acid aminotransferase).L'arbre semble respecter la congruence avec la phylogénie

des espèces. Cependant on ne peut pas dire de quel taxon provient cette séquence mais d'après l'arbre,

que la séquence inconnue est très proche des Cyanobacteries (Notre groupe d'etude), car possède un ancêtre

commun très proche avec les Cyanobacteries.

L'arbre semble respecter la congruence avec la phylogénie des espèces


    |         +-----------------Clostridium_novyi_NT_firmicutes_branched-chain_amino_acid_aminot
    |           +--------Persephonella_marina_EX-H1_aquificales_branched-chain_amino_acid
    |           |
    |    +------+  +----Sulfurihydrogenibium_azorense_Az-Fu1_aquificales_branched-chain
   ++    |      |  |
   ||    |      +--+  +SulfurihydrogenibiumYO3AOP1_aquificales_branched-chain_amino_aci
   ||    |         +--+
   ||    |            +SulfurihydrogenibiumSS-5_yellowstonense_aquificales_branched-cha
   ||    |
   ||    |     +-----------------------------Plesiocystis_pacifica_SIR-1_b-proteobacteria_branched-chain_amin
   ||    |     |
   |+----+     |
   |     |  +--+      +-------------------------Sphaerobacter_thermophilus_DSM_20745_GNS_bacteria_branched-chain
   |     |  |  |      |
   |     |  |  +------+              +ChloroflexusJ-10-fl_aurantiacus_GNS_bacteria_branched-chain_amin
   |     |  |         |      +-------+
   |     |  |         |      |       +ChloroflexusY-400-fl_sp_GNS_bacteria_branched-chain_amino_acid_a
   |     |  |         +------+
   |     |  |                |     +-RoseiflexusRS-1_GNS_bacteria_branched-chain_amino_acid_aminotran
   |     +--+                +-----+
   |        |                      +-Roseiflexus13941_castenholzii_GNS_bacteria_branched-chain_amino
   |        |
   |        |                         +Leptospira_biflexa1_serovar_spirochetes_branched-chain-amino-aci
   |        |              +----------+
   |        |              |          +Leptospira_biflexa2_serovar_spirochetes_Branched-chain_amino_aci
   |        +--------------+
   |                       |  +Leptospira_interrogans_spirochetes_branched-chain_amino_acid_ami
 +-+                       |  |
 | |                       +--+Leptospira1_borgpetersenii_serovar1_spirochetes_branched-chain_a
 | |                          |
 | |                          +Leptospira2_borgpetersenii_serovar2_spirochetes_branched-chain_a
 | |
 | |                                                  +marine_crenarchaeote_HF4000_APKG7F11_archaea_putative_aminotrans
 | |                                                  |
 | |                                                  |
 | |             +------------------------------------+marine_crenarchaeote_HF4000_ANIW133M9_archaea_putative_aminotran
 | |             |                                    |
 | |             |                                    +-marine_crenarchaeote_HF4000_APKG3H9_archaea_putative_aminotransf
 | |          +--+
 | |          |  |                     +---Sequence_Inconnue
 | |          |  |                     |
 | |          |  +---------------------+ +---ProchlorococcusMIT9515_marinus_cyanobacteria_branched-chain_amin
 | |          |                        | |
 | |          |                        +-++-ProchlorococcusstrAS9601_marinus_cyanobacteria_branched-chain_am
 | |          |                          ||
 | |   +------+                          +++ProchlorococcusstrMIT9301_marinus_cyanobacteria_branched-chain_a
 | |   |      |                           |+
 | |   |      |                           |+ProchlorococcusstrMIT9202_marinus_cyanobacteria_branched-chain_a
 | |   |      |                           |
 | +---+      |                           +ProchlorococcusstrMIT9312_marinus_cyanobacteria_branched-chain_a
 |     |      |
 |     |      +-----------------------------------------Cellulomonas_flavigena_DSM_20109_high_GC_Gram+_branched-chain_am
 |     |
 |     |   +----------------------------Rhodococcus_jostii_RHA1_high_GC_Gram+_branched-chain-amino-acid
 |     +---+
 |         +-------Hydrogenivirga128-5-R1-1_sp_aquificales_branched-chain_amino_aci
 |                    +--------------------------Natronomonas_pharaonis_DSM_2160_euryarchaeotes_branched-chain_am
 |                    |
 |             +------+
 |             |      |         +----------Methanothermobacter_thermautotrophicu._Delta_H_euryarchaeotes_br
 |             |      +---------+
 |             |                +-----------------------ProsthecochlorisDSM271_aestuarii_green_sulfur_bacteria_branched-
 |         +---+
 |         |   |                               +Acidovorax2AN_delafieldii_b-proteobacteria_branched-chain_amino
 |         |   |                 +-------------+
 |         |   |                 |             +-----DelftiaSPH-1_acidovorans_b-proteobacteria_branched-chain_amino_a
 +---------+   +-----------------+
           |                     |      +-----Burkholderia_ambifaria_MEX-5_b-proteobacteria_branched-chain_ami
           |                     +------+
           |                            +-------PolynucleobacterSTIR1_necessarius_b-proteobacteria_branched-chai

Taxonomy report

PROTOCOLE: Blast protéique contre All non-redundant GenBank CDS dans NCBI


D'après les résultats de Blast:

Groupe d'étude est : Cyanobacterie

Groupe exterieur : Aquificales,spirochetes,GNS bacteria,proteobacteria,archaea,euryarchaeotes,

green sulfur bacteria et high GC Gram+.

Cette séquence inconnue semble plus proche du groupe des Cyanobacteries au vue du nombre de hits

et des Evalues très significative( 2e-134 pour la meilleur).


cellular organisms
. Bacteria                [bacteria]
. . Cyanobacteria           [cyanobacteria]
. . . Prochlorococcus marinus [cyanobacteria]
. . . . Prochlorococcus marinus str. MIT 9515 ----------------------  481 2 hits [cyanobacteria]          branched-chain amino acid aminotransferase [Prochlorococcus
. . . . Prochlorococcus marinus str. AS9601 ........................  479 2 hits [cyanobacteria]          branched-chain amino acid aminotransferase [Prochlorococcus
. . . . Prochlorococcus marinus str. MIT 9301 ......................  476 2 hits [cyanobacteria]          branched-chain amino acid aminotransferase [Prochlorococcus
. . . . Prochlorococcus marinus str. MIT 9202 ......................  476 2 hits [cyanobacteria]          branched-chain amino acid aminotransferase [Prochlorococcus
. . . . Prochlorococcus marinus str. MIT 9312 ......................  475 2 hits [cyanobacteria]          branched-chain amino acid aminotransferase [Prochlorococcus
. . . . Prochlorococcus marinus str. MIT 9215 ......................  473 2 hits [cyanobacteria]          branched-chain amino acid aminotransferase [Prochlorococcus
. . . . Prochlorococcus marinus subsp. pastoris str. CCMP1986 ......  470 2 hits [cyanobacteria]          branched-chain amino acid aminotransferase [Prochlorococcus
. . . . Prochlorococcus marinus str. MIT 9211 ......................  431 2 hits [cyanobacteria]          branched-chain amino acid aminotransferase [Prochlorococcus
. . . . Prochlorococcus marinus str. MIT 9303 ......................  424 2 hits [cyanobacteria]          branched-chain amino acid aminotransferase [Prochlorococcus
. . . . Prochlorococcus marinus str. NATL1A ........................  424 2 hits [cyanobacteria]          branched-chain amino acid aminotransferase [Prochlorococcus
. . . . Prochlorococcus marinus str. MIT 9313 ......................  424 2 hits [cyanobacteria]          branched-chain amino acid aminotransferase [Prochlorococcus
. . . . Prochlorococcus marinus subsp. marinus str. CCMP1375 .......  422 2 hits [cyanobacteria]          branched-chain amino acid aminotransferase [Prochlorococcus
. . . . Prochlorococcus marinus str. NATL2A ........................  421 2 hits [cyanobacteria]          branched-chain amino acid aminotransferase [Prochlorococcus
. . . Synechococcus sp. RS9917 -------------------------------------  424 2 hits [cyanobacteria]          putative Branched-chain amino acid aminotransferase [Synech
. . . Synechococcus sp. BL107 ......................................  421 2 hits [cyanobacteria]          branched-chain amino acid aminotransferase [Synechococcus s
. . . Synechococcus sp. WH 7803 ....................................  418 2 hits [cyanobacteria]          branched-chain amino acid aminotransferase [Synechococcus s
. . . Synechococcus sp. CC9902 .....................................  417 2 hits [cyanobacteria]          branched-chain amino acid aminotransferase [Synechococcus s
. . . Synechococcus sp. WH 8109 ....................................  417 2 hits [cyanobacteria]          branched-chain amino acid aminotransferase [Synechococcus s
. . . Synechococcus sp. WH 7805 ....................................  415 2 hits [cyanobacteria]          branched-chain amino acid aminotransferase [Synechococcus s
. . . Cyanobium sp. PCC 7001 .......................................  415 2 hits [cyanobacteria]          branched-chain amino acid aminotransferase [Cyanobium sp. P
. . . Synechococcus sp. CC9605 .....................................  414 2 hits [cyanobacteria]          branched-chain amino acid aminotransferase [Synechococcus s
. . . Synechococcus sp. RS9916 .....................................  414 2 hits [cyanobacteria]          branched-chain amino acid aminotransferase [Synechococcus s
. . . Synechococcus sp. WH 8102 ....................................  413 2 hits [cyanobacteria]          branched-chain amino acid aminotransferase [Synechococcus s
. . . Synechococcus sp. CC9311 .....................................  407 2 hits [cyanobacteria]          branched-chain amino acid aminotransferase [Synechococcus s
. . . Synechococcus sp. RCC307 .....................................  405 2 hits [cyanobacteria]          branched-chain amino acid aminotransferase [Synechococcus s
. . . Synechococcus sp. WH 5701 ....................................  403 4 hits [cyanobacteria]          branched-chain amino acid aminotransferase [Synechococcus s
. . . Synechococcus sp. PCC 7002 ...................................  368 2 hits [cyanobacteria]          branched-chain amino acid aminotransferase [Synechococcus s
. . . Acaryochloris marina MBIC11017 ...............................  365 4 hits [cyanobacteria]          branched-chain amino acid aminotransferase [Acaryochloris m
. . . Synechococcus elongatus PCC 6301 .............................  362 2 hits [cyanobacteria]          branched-chain amino acid aminotransferase [Synechococcus e
. . . Synechococcus elongatus PCC 7942 .............................  362 2 hits [cyanobacteria]          branched-chain amino acid aminotransferase [Synechococcus e
. . . Cyanothece sp. ATCC 51142 ....................................  358 2 hits [cyanobacteria]          branched-chain amino acid aminotransferase [Cyanothece sp. 
. . . Crocosphaera watsonii WH 8501 ................................  352 2 hits [cyanobacteria]          Branched-chain amino acid aminotransferase I [Crocosphaera 
. . . Cyanothece sp. PCC 8801 ......................................  350 2 hits [cyanobacteria]          branched-chain amino acid aminotransferase [Cyanothece sp. 
. . . Cyanothece sp. PCC 8802 ......................................  350 2 hits [cyanobacteria]          branched-chain amino acid aminotransferase [Cyanothece sp. 
. . . Synechococcus sp. JA-3-3Ab ...................................  350 2 hits [cyanobacteria]          branched-chain amino acid aminotransferase [Synechococcus s
. . . Cyanothece sp. CCY0110 .......................................  349 2 hits [cyanobacteria]          branched-chain amino acid aminotransferase [Cyanothece sp. 
. . . Synechococcus sp. JA-2-3B'a(2-13) ............................  348 2 hits [cyanobacteria]          branched-chain amino acid aminotransferase [Synechococcus s
. . . Cyanothece sp. PCC 7822 ......................................  345 2 hits [cyanobacteria]          branched-chain amino acid aminotransferase [Cyanothece sp. 
. . . Microcoleus chthonoplastes PCC 7420 ..........................  345 2 hits [cyanobacteria]          branched-chain amino acid aminotransferase [Microcoleus cht
. . . Cyanothece sp. PCC 7425 ......................................  344 2 hits [cyanobacteria]          branched-chain amino acid aminotransferase [Cyanothece sp. 
. . . Synechocystis sp. PCC 6803 ...................................  337 3 hits [cyanobacteria]          branched-chain amino acid aminotransferase [Synechocystis s
. . . Microcystis aeruginosa PCC 7806 ..............................  337 1 hit  [cyanobacteria]          ilvE [Microcystis aeruginosa PCC 7806]
. . . Microcystis aeruginosa NIES-843 ..............................  337 2 hits [cyanobacteria]          branched-chain amino acid aminotransferase [Microcystis aer
. . . Cyanothece sp. PCC 7424 ......................................  334 2 hits [cyanobacteria]          branched-chain amino acid aminotransferase [Cyanothece sp. 
. . . Thermosynechococcus elongatus BP-1 ...........................  315 2 hits [cyanobacteria]          branched-chain amino acid aminotransferase [Thermosynechoco
. . . Gloeobacter violaceus PCC 7421 ...............................  183 2 hits [cyanobacteria]          branched-chain amino acid aminotransferase [Gloeobacter vio
. . Sulfurihydrogenibium azorense Az-Fu1 ---------------------------  214 2 hits [aquificales]            branched-chain amino acid aminotransferase [Sulfurihydrogen
. . Sulfurihydrogenibium sp. YO3AOP1 ...............................  211 2 hits [aquificales]            branched-chain amino acid aminotransferase [Sulfurihydrogen
. . Leptospira biflexa serovar Patoc strain 'Patoc 1 (Paris)' ......  209 2 hits [spirochetes]            branched-chain-amino-acid aminotransferase [Leptospira bifl
. . Leptospira biflexa serovar Patoc strain 'Patoc 1 (Ames)' .......  209 2 hits [spirochetes]            branched-chain-amino-acid aminotransferase [Leptospira bifl
. . Sphaerobacter thermophilus DSM 20745 ...........................  206 4 hits [GNS bacteria]           branched-chain amino acid aminotransferase [Sphaerobacter t
. . Leptospira borgpetersenii serovar Hardjo-bovis L550 ............  205 2 hits [spirochetes]            branched-chain amino acid aminotransferase [Leptospira borg
. . Leptospira borgpetersenii serovar Hardjo-bovis JB197 ...........  205 2 hits [spirochetes]            branched-chain amino acid aminotransferase [Leptospira borg
. . Leptospira interrogans .........................................  204 1 hit  [spirochetes]            putative branched-chain amino acid aminotransferase [Leptos
. . Leptospira interrogans serovar Lai str. 56601 ..................  204 2 hits [spirochetes]            branched-chain amino acid aminotransferase [Leptospira inte
. . Leptospira interrogans serovar Copenhageni str. Fiocruz L1-130 .  204 2 hits [spirochetes]            branched-chain amino acid aminotransferase [Leptospira inte
. . Persephonella marina EX-H1 .....................................  202 2 hits [aquificales]            branched-chain amino acid aminotransferase [Persephonella m
. . Roseiflexus sp. RS-1 ...........................................  201 2 hits [GNS bacteria]           branched-chain amino acid aminotransferase [Roseiflexus sp.
. . Sulfurihydrogenibium yellowstonense SS-5 .......................  200 2 hits [aquificales]            branched-chain amino acid aminotransferase [Sulfurihydrogen
. . Hydrogenivirga sp. 128-5-R1-1 ..................................  199 2 hits [aquificales]            branched-chain amino acid aminotransferase [Hydrogenivirga 
. . Chloroflexus aurantiacus J-10-fl ...............................  199 2 hits [GNS bacteria]           branched-chain amino acid aminotransferase [Chloroflexus au
. . Chloroflexus sp. Y-400-fl ......................................  199 2 hits [GNS bacteria]           branched-chain amino acid aminotransferase [Chloroflexus au
. . Thermobaculum terrenum ATCC BAA-798 ............................  198 4 hits [bacteria]               branched-chain amino acid aminotransferase [Thermobaculum t
. . Roseiflexus castenholzii DSM 13941 .............................  197 2 hits [GNS bacteria]           branched-chain amino acid aminotransferase [Roseiflexus cas
. . Aquifex aeolicus VF5 ...........................................  196 2 hits [aquificales]            branched-chain amino acid aminotransferase [Aquifex aeolicu
. . Aquifex aeolicus ...............................................  196 1 hit  [aquificales]            branched-chain amino acid aminotransferase [Aquifex aeolicu
. . Hydrogenobaculum sp. Y04AAS1 ...................................  196 2 hits [aquificales]            branched-chain amino acid aminotransferase [Hydrogenobaculu
. . Chloroflexus aggregans DSM 9485 ................................  193 2 hits [GNS bacteria]           branched-chain amino acid aminotransferase [Chloroflexus ag
. . Dehalococcoides sp. VS .........................................  192 2 hits [GNS bacteria]           branched-chain amino acid aminotransferase [Dehalococcoides
. . Dehalococcoides ethenogenes 195 ................................  192 2 hits [GNS bacteria]           branched-chain amino acid aminotransferase [Dehalococcoides
. . Dehalococcoides sp. GT .........................................  191 2 hits [GNS bacteria]           branched-chain amino acid aminotransferase [Dehalococcoides
. . Thermomicrobium roseum DSM 5159 ................................  191 2 hits [GNS bacteria]           branched-chain amino acid aminotransferase [Thermomicrobium
. . Dehalococcoides sp. CBDB1 ......................................  191 2 hits [GNS bacteria]           branched-chain amino acid aminotransferase [Dehalococcoides
. . Dehalococcoides sp. BAV1 .......................................  191 2 hits [GNS bacteria]           branched-chain amino acid aminotransferase [Dehalococcoides
. . Plesiocystis pacifica SIR-1 ....................................  187 2 hits [d-proteobacteria]       branched-chain amino acid aminotransferase [Plesiocystis pa
. . Clostridium cellulovorans 743B .................................  179 2 hits [firmicutes]             branched-chain amino acid aminotransferase [Clostridium cel
. . Clostridium novyi NT ...........................................  178 4 hits [firmicutes]             branched-chain amino acid aminotransferase [Clostridium nov
. . Herpetosiphon aurantiacus ATCC 23779 ...........................  177 2 hits [GNS bacteria]           branched-chain amino acid aminotransferase [Herpetosiphon a
. . Clostridium botulinum C str. Eklund ............................  176 4 hits [firmicutes]             branched-chain amino acid aminotransferase [Clostridium bot
. . Erwinia pyrifoliae Ep1/96 ......................................  171 2 hits [enterobacteria]         Similar to branched-chain amino acid aminotransferase [Erwi
. . Burkholderia sp. H160 ..........................................  168 2 hits [b-proteobacteria]       branched-chain amino acid aminotransferase [Burkholderia sp
. . Cellulomonas flavigena DSM 20109 ...............................  166 2 hits [high GC Gram+]          branched-chain amino acid aminotransferase, group I [Cellul
. . Burkholderia sp. CCGE1002 ......................................  164 1 hit  [b-proteobacteria]       branched-chain amino acid aminotransferase [Burkholderia sp
. . Halothiobacillus neapolitanus c2 ...............................  164 2 hits [g-proteobacteria]       branched-chain amino acid aminotransferase [Halothiobacillu
. . Burkholderia ambifaria MEX-5 ...................................  164 2 hits [b-proteobacteria]       branched-chain amino acid aminotransferase [Burkholderia am
. . Prosthecochloris aestuarii DSM 271 .............................  163 2 hits [green sulfur bacteria]  branched-chain amino acid aminotransferase [Prosthecochlori
. . Rhodococcus jostii RHA1 ........................................  162 2 hits [high GC Gram+]          branched-chain-amino-acid transaminase [Rhodococcus jostii 
. . Polynucleobacter necessarius subsp. necessarius STIR1 ..........  162 2 hits [b-proteobacteria]       branched-chain amino acid aminotransferase [Polynucleobacte
. . Candidatus Koribacter versatilis Ellin345 ......................  162 2 hits [bacteria]               branched chain amino acid aminotransferase / branched chain
. . Acidovorax delafieldii 2AN .....................................  162 2 hits [b-proteobacteria]       branched-chain amino acid aminotransferase [Acidovorax dela
. Paulinella chromatophora -----------------------------------------  413 2 hits [cercozoans]             branched-chain amino acid aminotransferase [Paulinella chro
. Nitrosopumilus maritimus SCM1 ....................................  186 2 hits [archaea]                branched-chain amino acid aminotransferase [Nitrosopumilus 
. Pyrobaculum arsenaticum DSM 13514 ................................  184 2 hits [crenarchaeotes]         branched-chain amino acid aminotransferase [Pyrobaculum ars
. Pyrobaculum aerophilum str. IM2 ..................................  183 2 hits [crenarchaeotes]         branched-chain amino acid aminotransferase [Pyrobaculum aer
. Candidatus Micrarchaeum acidiphilum ARMAN-2 ......................  182 1 hit  [euryarchaeotes]         branched-chain amino acid aminotransferase [Candidatus Micr
. Pyrobaculum calidifontis JCM 11548 ...............................  176 2 hits [crenarchaeotes]         branched-chain amino acid aminotransferase [Pyrobaculum cal
. uncultured marine crenarchaeote HF4000_APKG7F11 ..................  173 1 hit  [archaea]                putative aminotransferase class IV [uncultured marine crena
. uncultured marine crenarchaeote HF4000_ANIW133M9 .................  172 1 hit  [archaea]                putative aminotransferase class IV [uncultured marine crena
. uncultured marine crenarchaeote HF4000_APKG3H9 ...................  170 1 hit  [archaea]                putative aminotransferase class IV [uncultured marine crena
. Methanothermobacter thermautotrophicus str. Delta H ..............  164 3 hits [euryarchaeotes]         branched-chain amino-acid aminotransferase [Methanothermoba
. Natronomonas pharaonis DSM 2160 ..................................  164 2 hits [euryarchaeotes]         branched-chain amino acid aminotransferase [Natronomonas ph



PROTOCOLE: Blast protéique contre All non-redundant GenBank CDS dans NCBI

ANALYSE DES RÉSULTATS:Blast protéique contre All non-redundant GenBank CDS dans NCBI

D'après les resultats de Blast, il y a 100 Blast hits. Les espèces trouvées avec des E-Values très significatives

sont: Cyanobacteria,aquificales,spirochetes,GNS bacteria,proteobacteria,archaea,euryarchaeotes,

green sulfur bacteria et high GC Gram+.

D'après les résultats de Blast, cette séquence inconnue est très clairement proche d'une branched-chain-amino-acid

aminotransferase avec des E-values très significatives (La meilleure E-Value est de 2e-134).

Cette protéine fait partie de la famille des Aminotransferase class IV et donc cette protéine

semble avoir une fonction faisant partie des transaminases, capable d'échanger la fonction chimique amine

(-nh2) d'un Acide aminé donné contre une fonction cétonique (co).


                                                              Score     E
Sequences producing significant alignments:                       (Bits)  Value

ref|YP_001011274.1|  branched-chain amino acid aminotransferas...   481    2e-134 Gene info
ref|YP_001009374.1|  branched-chain amino acid aminotransferas...   479    1e-133 Gene info
ref|YP_001091205.1|  branched-chain amino acid aminotransferas...   476    1e-132 Gene info
ref|ZP_05138108.1|  branched-chain amino acid aminotransferase...   476    1e-132
ref|YP_397418.1|  branched-chain amino acid aminotransferase [...   475    2e-132 Gene info
ref|YP_001484215.1|  branched-chain amino acid aminotransferas...   473    6e-132 Gene info
ref|NP_892996.1|  branched-chain amino acid aminotransferase [...   470    5e-131 Gene info
ref|YP_001550771.1|  branched-chain amino acid aminotransferas...   431    3e-119 Gene info
ref|YP_001017501.1|  branched-chain amino acid aminotransferas...   424    3e-117 Gene info
ref|YP_001014828.1|  branched-chain amino acid aminotransferas...   424    4e-117 Gene info
ref|NP_894560.1|  branched-chain amino acid aminotransferase [...   424    5e-117 Gene info
ref|ZP_01080324.1|  putative Branched-chain amino acid aminotr...   424    5e-117
ref|NP_875350.1|  branched-chain amino acid aminotransferase [...   422    2e-116 Gene info
ref|ZP_01467832.1|  branched-chain amino acid aminotransferase...   421    3e-116
ref|YP_291527.1|  branched-chain amino acid aminotransferase [...   421    3e-116 Gene info
ref|YP_001224999.1|  branched-chain amino acid aminotransferas...   418    3e-115 Gene info
ref|YP_377130.1|  branched-chain amino acid aminotransferase [...   417    4e-115 Gene info
ref|ZP_05789921.1|  branched-chain amino acid aminotransferase...   417    5e-115
ref|ZP_01124051.1|  branched-chain amino acid aminotransferase...   415    3e-114
ref|ZP_05044849.1|  branched-chain amino acid aminotransferase...   415    3e-114
ref|YP_381665.1|  branched-chain amino acid aminotransferase [...   414    5e-114 Gene info
ref|ZP_01472122.1|  branched-chain amino acid aminotransferase...   414    6e-114
ref|YP_002048809.1|  branched-chain amino acid aminotransferas...   413    7e-114 Gene info
ref|NP_897332.1|  branched-chain amino acid aminotransferase [...   413    9e-114 Gene info
ref|YP_730561.1|  branched-chain amino acid aminotransferase [...   407    6e-112 Gene info
ref|YP_001227464.1|  branched-chain amino acid aminotransferas...   405    3e-111 Gene info
ref|ZP_01085489.1|  branched-chain amino acid aminotransferase...   403    1e-110
ref|ZP_01086663.1|  branched-chain amino acid aminotransferase...   383    8e-105
ref|YP_001735107.1|  branched-chain amino acid aminotransferas...   368    3e-100 Gene info
ref|YP_001517952.1|  branched-chain amino acid aminotransferas...   365    2e-99  Gene info
ref|YP_171227.1|  branched-chain amino acid aminotransferase [...   362    2e-98  Gene info
ref|YP_001803030.1|  branched-chain amino acid aminotransferas...   358    2e-97  Gene info
ref|ZP_00514261.1|  Branched-chain amino acid aminotransferase...   352    3e-95 
ref|YP_002372958.1|  branched-chain amino acid aminotransferas...   350    8e-95  Gene info
ref|YP_474467.1|  branched-chain amino acid aminotransferase [...   350    1e-94  Gene info
ref|ZP_01731042.1|  branched-chain amino acid aminotransferase...   349    2e-94 
ref|YP_476735.1|  branched-chain amino acid aminotransferase [...   348    4e-94  Gene info
ref|ZP_03157805.1|  branched-chain amino acid aminotransferase...   345    3e-93 
ref|ZP_05030687.1|  branched-chain amino acid aminotransferase...   345    4e-93 
ref|YP_002482757.1|  branched-chain amino acid aminotransferas...   344    6e-93  Gene info
ref|NP_442721.1|  branched-chain amino acid aminotransferase [...   337    5e-91  Gene info
emb|CAO86637.1|  ilvE [Microcystis aeruginosa PCC 7806]             337    9e-91 
ref|YP_001658925.1|  branched-chain amino acid aminotransferas...   337    1e-90  Gene info
ref|YP_002380025.1|  branched-chain amino acid aminotransferas...   334    6e-90  Gene info
ref|NP_682252.1|  branched-chain amino acid aminotransferase [...   315    2e-84  Gene info
ref|YP_001519607.1|  branched-chain amino acid aminotransferas...   313    1e-83  Gene info
ref|YP_002728748.1|  branched-chain amino acid aminotransferas...   214    8e-54  Gene info
ref|YP_001931393.1|  branched-chain amino acid aminotransferas...   211    5e-53  Gene info
ref|YP_001840813.1|  branched-chain-amino-acid aminotransferas...   209    2e-52  Gene info
ref|YP_003318647.1|  branched-chain amino acid aminotransferas...   206    1e-51  Gene info
ref|YP_796574.1|  branched-chain amino acid aminotransferase [...   205    4e-51  Gene info
gb|AAN64007.1|AF434658_4  putative branched-chain amino acid a...   204    7e-51 
ref|NP_714540.1|  branched-chain amino acid aminotransferase [...   204    1e-50  Gene info
ref|YP_002731002.1|  branched-chain amino acid aminotransferas...   202    3e-50  Gene info
ref|YP_001276870.1|  branched-chain amino acid aminotransferas...   201    4e-50  Gene info
ref|ZP_04584906.1|  branched-chain amino acid aminotransferase...   200    2e-49 
ref|ZP_02178591.1|  branched-chain amino acid aminotransferase...   199    2e-49 
ref|YP_001635052.1|  branched-chain amino acid aminotransferas...   199    3e-49  Gene info
ref|YP_003322521.1|  branched-chain amino acid aminotransferas...   198    4e-49 
ref|YP_001432577.1|  branched-chain amino acid aminotransferas...   197    6e-49  Gene info
ref|NP_214301.1|  branched-chain amino acid aminotransferase [...   196    2e-48  Gene info
ref|YP_002122029.1|  branched-chain amino acid aminotransferas...   196    2e-48  Gene info
ref|YP_002463002.1|  branched-chain amino acid aminotransferas...   193    1e-47  Gene info
gb|ACZ61190.1|  branched-chain amino acid aminotransferase [De...   192    3e-47 
ref|YP_180764.1|  branched-chain amino acid aminotransferase [...   192    4e-47  Gene info
ref|ZP_06170000.1|  branched-chain amino acid aminotransferase...   191    5e-47 
ref|YP_002522829.1|  branched-chain amino acid aminotransferas...   191    1e-46  Gene info
ref|YP_307204.1|  branched-chain amino acid aminotransferase [...   191    1e-46  Gene info
ref|ZP_01913206.1|  branched-chain amino acid aminotransferase...   187    1e-45 
ref|YP_001581582.1|  branched-chain amino acid aminotransferas...   186    2e-45  Gene info
ref|YP_001153924.1|  branched-chain amino acid aminotransferas...   184    7e-45  Gene info
ref|NP_924171.1|  branched-chain amino acid aminotransferase [...   183    2e-44  Gene info
ref|NP_560638.1|  branched-chain amino acid aminotransferase [...   183    2e-44  Gene info
gb|EET89855.1|  branched-chain amino acid aminotransferase [Ca...   182    4e-44 
ref|ZP_04805250.1|  branched-chain amino acid aminotransferase...   179    2e-43 
ref|YP_003321935.1|  branched-chain amino acid aminotransferas...   178    5e-43 
ref|YP_878103.1|  branched-chain amino acid aminotransferase [...   178    6e-43  Gene info
ref|YP_001546126.1|  branched-chain amino acid aminotransferas...   177    1e-42  Gene info
ref|ZP_02620903.1|  branched-chain amino acid aminotransferase...   176    2e-42 
ref|YP_001056639.1|  branched-chain amino acid aminotransferas...   176    3e-42  Gene info
gb|ABZ09245.1|  putative aminotransferase class IV [uncultured...   173    2e-41 
gb|ABZ07409.1|  putative aminotransferase class IV [uncultured...   172    2e-41 
ref|YP_002648450.1|  Similar to branched-chain amino acid amin...   171    8e-41  Gene info
gb|ABZ08611.1|  putative aminotransferase class IV [uncultured...   170    2e-40 
ref|ZP_03267166.1|  branched-chain amino acid aminotransferase...   168    6e-40 
ref|ZP_04365549.1|  branched-chain amino acid aminotransferase...   166    2e-39 
ref|YP_878687.1|  branched-chain amino acid aminotransferase [...   166    3e-39  Gene info
ref|YP_003318569.1|  branched-chain amino acid aminotransferas...   166    3e-39  Gene info
ref|ZP_02621086.1|  branched-chain amino acid aminotransferase...   165    3e-39 
ref|YP_003263999.1|  branched-chain amino acid aminotransferas...   164    7e-39  Gene info
ref|NP_276546.1|  branched-chain amino-acid aminotransferase [...   164    1e-38  Gene info
sp|O27481.2|ILVE_METTH  RecName: Full=Putative branched-chain-...   164    1e-38 
ref|ZP_02905019.1|  branched-chain amino acid aminotransferase...   164    1e-38 
ref|YP_331241.1|  branched-chain amino acid aminotransferase [...   164    1e-38  Gene info
ref|YP_002015252.1|  branched-chain amino acid aminotransferas...   163    1e-38  Gene info
ref|YP_702933.1|  branched-chain-amino-acid transaminase [Rhod...   162    3e-38  Gene info
ref|YP_001798232.1|  branched-chain amino acid aminotransferas...   162    3e-38  Gene info
ref|YP_589791.1|  branched chain amino acid aminotransferase /...   162    3e-38  Gene info
ref|ZP_04763517.1|  branched-chain amino acid aminotransferase...   162    4e-38 
ref|YP_001561347.1|  branched-chain amino acid aminotransferas...   162    5e-38  Gene info