Toutes nos excuses pour l'interruption momentanée cet après-midi, tout est rentrée dans l'ordre pour l'Annotathon et les outils TaxReport et DefList !

Forum "ORF finding"

Sujet de discussion: FASTA

[ Retour aux forums ]
FASTA
riceline
26 Jul 2018 10:42
Contribution non évaluée
ACTGAATTATTTTTTACTGAGCTTGTGAAAAAGGAAAATGATTGGGCTATTTTGGATAATGATAATTCTGAGGCAGATGATTTTTTACGAAAGTTACTGG
ATTATTTTTCTTCAGCTACTGTTTCTCAAGGCACTTCCTTGGTTGCCTTAAACTTAAATCAAGGCCGAAAGTCTGAGGTAATCAATACAGATGATGGAAA
ATCATATATCAAGCTGAGTATAGGTTTTGCCAGAACTTGGGCAGCTCTGAACAGGGCTCTTAAAGAGGCAGCAATTAGTATTAAAGATCTAAACAGAGAG
GAGGGCTATGTTTTGATTAATTATGGTTTGCCTGAAGAAGAGGGAATCCTTGCAAGACTTAGAAAAAGTGAGCCTAAAGAGTATAAAATTATTGTAAGAT
CATCTTCAGAAGATCTAACTCAAATAATGTTAGATTCAGAAGAATGGAATGATGAACTTGAAAGCCTTCTGTCTGAAATTAATCAATCTCTATCTTAAAT
ATTAATTATGAAAAAAATAGAACTTTTATCGAGCGGCAAGGCAAAATCTTTATATACAACTGAAAATTCTGATCAGCTTATTATGGAGTACAGAGATGAT
ACTTCTGCTTTTGATGGGAAAAAAATAGAAAAACTTGCTGGCAAGGGAACTGTAAATAACAGGTTTAATGCACATGTTATGCAACAAATAGAAAAATCTG
GCATACCAACTCATTTCATTGACGAGGTCTCAGAAAATGAAAGTCTTGTTAGGAAGTTAGAAATGGTTCCAATTGAATGTGTTGTGAGGAATATCACAGC
TGGGAGCATATGCAAAAGATTGGGGCTTGAGGAAGGCATGGAGCTTAATCCTCCAACGTTTGAATTTTTCTATAAAGATGATGAGTTAGGCGATCCAATG
GTAAATGA