GOS 781010

From Metagenes
Warning: this metagenomic sequence has been carefully annotated by students during bioinformatics assignments. These quality annotations are therefore the result of a teaching exercise that you are most welcome to amend and extend if necessary!

CAMERA AccNum : JCVI_READ_1091120595550
Annotathon code: GOS_781010
Sample :
  • GPS :24°29'18n; 83°4'12w
  • Caribbean Sea: Off Key West, FL - USA
  • Coastal (-1.7m, 25°C, 0.1-0.8 microns)
Team : RedDragons09
Username : Jaime09
Annotated on : 2009-05-12 21:24:43
  • Hoey Jaime


  • Taxonomy: marine gamma proteobacterium HTCC2148 (NCBI info)
    Rank: species - Genetic Code: Bacterial and Plant Plastid - NCBI Identifier: 247634
    Kingdom: Bacteria - Phylum: Proteobacteria - Class: Gammaproteobacteria - Order:
    Bacteria; Proteobacteria; Gammaproteobacteria;

Genomic Sequence

>JCVI_READ_1091120595550 GOS_781010 Genomic DNA


[138 - 929/931]   indirect strand
>GOS_781010 Translation [138-929   indirect strand]

[ Warning ] 3' incomplete: following codon is not a STOP

Annotator commentaries

The section of the DNA investigated included an ORF in the -3 reading frame that was predicted to encode a polypeptide of 264 amino acids. It was 794 bases long with a predicted molecular weight of 29.5 kilodaltons. The biological process and molecular function of the protein are unknown and it seems to be most closely related to g-proteobacteria. This can be confirmed when looking at both phylogenetic trees.

ORF finding


NCBI ORF finder


Frame -3 is predicted to encode a 264 amino acid polypeptide. The ORF starts with an ATG (going from 3' to 5') and is 794 bases long.


Frame  from  to Length 
-3     1 .. 794 794 
+1     430 .. 552 123 
-1     2 .. 103 102 

794 atgccacaaacggaggagcatttatcaatcttacaattacttcag
        M  P  Q  T  E  E  H  L  S  I  L  Q  L  L  Q 
    749 gtaaaaaattgtatcattgtattgaccaaaatagataaagttaat
        V  K  N  C  I  I  V  L  T  K  I  D  K  V  N 
    704 cagaagagattagataatgtttgttgtcttataaagaaaatgatg
        Q  K  R  L  D  N  V  C  C  L  I  K  K  M  M 
    659 cacaaaacaattttctcagatgctgaaatttttcacatttctaac
        H  K  T  I  F  S  D  A  E  I  F  H  I  S  N 
    614 aaaaccagtcaaggtattgataatttagtcagtcacttaaaaatc
        K  T  S  Q  G  I  D  N  L  V  S  H  L  K  I 
    569 atcgctctgaactatcatcataaagaagtaaaaggaaattttaga
        I  A  L  N  Y  H  H  K  E  V  K  G  N  F  R 
    524 ctgtcggttgataggagatttttagtaaaaggatctggtatagtt
        L  S  V  D  R  R  F  L  V  K  G  S  G  I  V 
    479 ataactggtacagttgtttcgggtgaagttagtgttggggaagaa
        I  T  G  T  V  V  S  G  E  V  S  V  G  E  E 
    434 ctcatacattcaaaatcaggcgaaagtttgaaaatccgtgctata
        L  I  H  S  K  S  G  E  S  L  K  I  R  A  I 
    389 catagtcaaagtaagaaaagtaagaatggaatacagggtcaccgt
        H  S  Q  S  K  K  S  K  N  G  I  Q  G  H  R 
    344 tgttctcttaatattactggacaaaaaattactatagataaaata
        C  S  L  N  I  T  G  Q  K  I  T  I  D  K  I 
    299 agtcgaggagattggatattatcaaaaaatgttttttttgtaaca
        S  R  G  D  W  I  L  S  K  N  V  F  F  V  T 
    254 aatagattagatgcagttctctcaattttaaaaaatgagaaaaaa
        N  R  L  D  A  V  L  S  I  L  K  N  E  K  K 
    209 atatttaaacattggacagctatacatctatatttgggttcagga
        I  F  K  H  W  T  A  I  H  L  Y  L  G  S  G 
    164 aatgtaactggtcgtattgctattttaggaagtttttctatcaat
        N  V  T  G  R  I  A  I  L  G  S  F  S  I  N 
    119 ccaggtgaaaagaaaattgttcaactggtattggacaaaccagtt
        P  G  E  K  K  I  V  Q  L  V  L  D  K  P  V 
     74 catgcagtatttgatgacaaattcgttattagagatatatcatct
        H  A  V  F  D  D  K  F  V  I  R  D  I  S  S 
     29 agtcgaacaattggtggaggatacatttt 1      
        S  R  T  I  G  G  G  Y  I 

FASTA protein sequence 

>lcl|Sequence 1 ORF:1..794 Frame -3

FASTA nucleotide sequence 

>lcl|Sequence 1 ORF:1..794 Frame -3

430 atgagttcttccccaacactaacttcacccgaaacaactgtacca
        M  S  S  S  P  T  L  T  S  P  E  T  T  V  P 
    475 gttataactataccagatccttttactaaaaatctcctatcaacc
        V  I  T  I  P  D  P  F  T  K  N  L  L  S  T 
    520 gacagtctaaaatttccttttacttctttatga 552    
        D  S  L  K  F  P  F  T  S  L  * 

103 ttgttcaactggtattggacaaaccagttcatgcagtatttgatg
        L  F  N  W  Y  W  T  N  Q  F  M  Q  Y  L  M 
     58 acaaattcgttattagagatatatcatctagtcgaacaattggtg
        T  N  S  L  L  E  I  Y  H  L  V  E  Q  L  V 
     13 gaggatacattt 2      
        E  D  T  F

Multiple Alignement


NCBI Blast - protein blast

Taxonomic report

EBI program

T-Coffee to get multiple allignment

T-COFFEE, Version_6.85(Tue Sep 9 14:03:25 WEST 2008)

Cedric Notredame

CPU TIME:9 sec.



In group _ g proteobacteria

Out group _ b-proteobacteria


CLUSTAL FORMAT for T-COFFEE Version_6.85 [http://www.tcoffee.org] [MODE:  ], CPU=9.61 sec, SCORE=79, Nseq=11, Len=669 

lcl|Sequen      ------------------------------------------------------------ 0

lcl|Sequen      ------------------------------------MPQTEEHLSILQLLQVKNCIIVLT 24
                                                    **** ***  ::*: : .  :.::

                * *:.   ::  *   :  :        :  :          *:  *   :         

                    .     **:.:** * : * * ::**:.  *    .: :         :: .:* :

                .:    .  *:* ::*::.  :    :  *.*:           .*  : :       : 

                .: .:*:: *:    .::.:* .      *     *:: : .     .* :: *:  : *

lcl|Sequen      TIGGGYI----------------------------------------------------- 264
                 :.** :                                                     

lcl|Sequen      ------------------------------------------------------------ 264

lcl|Sequen      ------------------------------------------------------------ 264

lcl|Sequen      ------------------------------------------------------------ 264

lcl|Sequen      ------------------------------------------------------------ 264

lcl|Sequen      --------- 264
Paeruginos      EQLLGGVSP 641
Pstutzeri       IQSGL---G 638
Pentomophi      QPQRG---P 640
Pputida_gi      QQQAR---H 640
Pfluoresce      NPGA----D 636
Mgamma_pro      SDIFG---D 642
Smaltpholi      EAR-----D 643
Dacidovora      TGATA--RI 643
Reutopha_g      ELL------ 636
Ctestoster      STQ-----R 641

Protein Domains


InterPro Scan to find Protein Domains


There were 4 proteins found, all involved with protein synthesis or translation.


InterPro IPR000795 PF00009 Protein synthesis factor, GTP-binding 
InterPro IPR004161 Pf03144 Translation elongation factor EFTu/EF1A, domain 2 
InterPro IPR009000 SSF50447 Translation elongation and initiation factors/Ribosomal, beta-barrel 
InterPro IPR009001 SSF50465 Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal 

Sequence	B7B007BD0A9805FC	264	HMMPanther	PTHR23115:SF39	ELONGATION FACTOR SELB	1	179	1.7e-35	T	17-Feb-2009	NULL	NULL	
Sequence	B7B007BD0A9805FC	264	HMMPanther	PTHR23115	TRANSLATION FACTOR	1	179	1.7e-35	T	17-Feb-2009	NULL	NULL	
Sequence	B7B007BD0A9805FC	264	superfamily	SSF50465	EF-Tu/eEF-1alpha/eIF2-gamma C-terminal domain	180	264	7.3e-16	T	17-Feb-2009	IPR009001	Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal	
Sequence	B7B007BD0A9805FC	264	superfamily	SSF50447	Translation proteins	84	175	1.4e-14	T	17-Feb-2009	IPR009000	Translation elongation and initiation factors/Ribosomal, beta-barrel	
Sequence	B7B007BD0A9805FC	264	superfamily	SSF52540	P-loop containing nucleoside triphosphate hydrolases	1	74	2.5e-10	T	17-Feb-2009	NULL	NULL	
Sequence	B7B007BD0A9805FC	264	Gene3D	G3DSA:	no description	1	73	1.7e-08	T	17-Feb-2009	NULL	NULL	
Sequence	B7B007BD0A9805FC	264	Gene3D	G3DSA:	no description	84	209	4.9e-19	T	17-Feb-2009	NULL	NULL	
Sequence	B7B007BD0A9805FC	264	HMMPfam	PF00009	GTP_EFTU	1	78	2.5e-09	T	17-Feb-2009	IPR000795	Protein synthesis factor, GTP-binding	Molecular Function: GTPase activity (GO:0003924), Molecular Function: GTP binding (GO:0005525)
Sequence	B7B007BD0A9805FC	264	HMMPfam	PF03144	GTP_EFTU_D2	103	172	6.3e-08	T	17-Feb-2009	IPR004161	Translation elongation factor EFTu/EF1A, domain 2	Molecular Function: GTP binding (GO:0005525)



a) Phylogeny.fr / BioNJ method / out group: b-proteobacteria

b) Phylogeny.fr / PhyML method / no bootstrap / default substitution model / out group: b-proteobacteria


The trees are coherent with the reference phylogeny of the species.

The metagenomic sequence appears to belong to the g-proteobacteria taxonomic group.


Tree A using BIONJ 

             +----------------------------------------------------------------------lcl_Sequen                                  (g-proteobacteria)                                        
 |         +--------------------------------------------------------------------------------------------------Mgamma_pro        (g-proteobacteria)
 |                                                                                    +-------------Pentomophi                  (g-proteobacteria)
 |                                                                +-------------------+
 |                                                       +--------+                   +-----------Pputida_gi                    (g-proteobacteria)
 |                                                       |        |
 |                                                       |        +---------------------------------Pfluoresce                  (g-proteobacteria)
 |                       +-------------------------------+
 |                       |                               |    +----------------------------Paeruginos                           (g-proteobacteria)
 |                       |                               |    |
 |                       |                               +----+
 +-----------------------+                                    +--------------------------Pstutzeri                              (g-proteobacteria)
                         |               +----------------------------------------------------------Smaltpholi                  (g-proteobacteria)
                         |               |
                         +---------------+   +------------------------------------------------------Reutopha_g                  (b-proteobacteria)
                                         |   |
                                             |                  +--------------------------Dacidovora                           (b-proteobacteria)
                                                                +-----------------------------Ctestoster                        (b-proteobacteria)
 Tree B using PhyML 

 |        +----------------------------------------------------------------------------Mgamma_pro                               (g-proteobacteria)
 |                                                                                                   +--------Pentomophi        (g-proteobacteria)
 |                                                                         +-------------------------+
 |                                                             +-----------+                         +------Pputida_gi          (g-proteobacteria)
 |                                                             |           |
 |                                                    +--------+           +---------------------Pfluoresce                     (g-proteobacteria)
 |                                                    |        |
 |                                                    |        +---------------------Paeruginos                                 (g-proteobacteria)
 |                 +----------------------------------+
 |                 |                                  |
 |                 |                                  +-----------------Pstutzeri                                               (g-proteobacteria)
 |                 |
 +-----------------+                                        +---------------------Dacidovora                                    (b-proteobacteria)
                   |                         +--------------+
                   |                         |              +-----------------------------Ctestoster                            (b-proteobacteria)
                   |                         |
                                             |   +------------------------------------------------------------Smaltpholi        (g-proteobacteria)
                                                 +----------------------------------------------------Reutopha_g                (b-proteobacteria)

Taxonomy report


In-group - g-proteobacteria

Out-group - b-proteobacteria



Bacteria               [bacteria]
. Proteobacteria         [proteobacteria]
. . Gammaproteobacteria    [g-proteobacteria]
. . . Pseudomonas            [g-proteobacteria]
. . . . Pseudomonas aeruginosa [g-proteobacteria]
. . . . . Pseudomonas aeruginosa PAO1 ----------------  240 2 hits [g-proteobacteria]  selenocysteine-specific elongation factor [Pseudomonas aeru
. . . . . Pseudomonas aeruginosa PACS2 ...............  240 1 hit  [g-proteobacteria]  selenocysteine-specific elongation factor [Pseudomonas aeru
. . . . . Pseudomonas aeruginosa LESB58 ..............  240 2 hits [g-proteobacteria]  selenocysteine-specific elongation factor [Pseudomonas aeru
. . . . . Pseudomonas aeruginosa UCBPP-PA14 ..........  239 2 hits [g-proteobacteria]  selenocysteine-specific elongation factor [Pseudomonas aeru
. . . . . Pseudomonas aeruginosa PA7 .................  231 2 hits [g-proteobacteria]  selenocysteine-specific elongation factor [Pseudomonas aeru
. . . . Pseudomonas stutzeri A1501 -------------------  226 2 hits [g-proteobacteria]  selenocysteine-specific elongation factor [Pseudomonas stut
. . . . Pseudomonas entomophila L48 ..................  219 2 hits [g-proteobacteria]  selenocysteinyl-tRNA-specific translation factor [Pseudomon
. . . . Pseudomonas putida F1 ........................  213 2 hits [g-proteobacteria]  selenocysteine-specific translation elongation factor [Pseu
. . . . Pseudomonas putida KT2440 ....................  212 2 hits [g-proteobacteria]  selenocysteine-specific translation elongation factor [Pseu
. . . . Pseudomonas putida GB-1 ......................  210 2 hits [g-proteobacteria]  selenocysteine-specific translation elongation factor [Pseu
. . . . Pseudomonas putida W619 ......................  210 2 hits [g-proteobacteria]  selenocysteine-specific translation elongation factor [Pseu
. . . . Pseudomonas fluorescens Pf0-1 ................  209 2 hits [g-proteobacteria]  selenocysteine-specific translation elongation factor SelB 
. . . marine gamma proteobacterium HTCC2143 ----------  217 4 hits [g-proteobacteria]  selenocysteine-specific elongation factor [marine gamma pro
. . . Providencia rettgeri DSM 1131 ..................  182 2 hits [enterobacteria]    hypothetical protein PROVRETT_01896 [Providencia rettgeri D
. . . Stenotrophomonas maltophilia R551-3 ............  176 2 hits [g-proteobacteria]  selenocysteine-specific translation elongation factor [Sten
. . . Providencia stuartii ATCC 25827 ................  176 2 hits [enterobacteria]    hypothetical protein PROSTU_00436 [Providencia stuartii ATC
. . . Mannheimia haemolytica PHL213 ..................  171 2 hits [g-proteobacteria]  selenocysteine-specific translation elongation factor [Mann
. . . Providencia alcalifaciens DSM 30120 ............  170 2 hits [enterobacteria]    hypothetical protein PROVALCAL_03690 [Providencia alcalifac
. . . Escherichia fergusonii ATCC 35469 ..............  167 2 hits [enterobacteria]    selenocysteinyl-tRNA-specific translation factor [Escherich
. . . Serratia proteamaculans 568 ....................  166 2 hits [enterobacteria]    selenocysteinyl-tRNA-specific translation factor [Serratia 
. . . Cronobacter sakazakii ATCC BAA-894 .............  166 2 hits [enterobacteria]    selenocysteinyl-tRNA-specific translation factor [Enterobac
. . . Stenotrophomonas maltophilia K279a .............  166 2 hits [g-proteobacteria]  putative selenocysteine-specific elongation factor [Stenotr
. . . Photorhabdus luminescens subsp. laumondii TTO1 .  166 2 hits [enterobacteria]    selenocysteinyl-tRNA-specific translation factor [Photorhab
. . . Providencia rustigianii DSM 4541 ...............  166 2 hits [enterobacteria]    hypothetical protein PROVRUST_00072 [Providencia rustigiani
. . . Escherichia coli 536 ...........................  165 2 hits [enterobacteria]    selenocysteinyl-tRNA-specific translation factor [Escherich
. . . Escherichia coli F11 ...........................  165 2 hits [enterobacteria]    selenocysteinyl-tRNA-specific translation factor [Escherich
. . . Escherichia coli ED1a ..........................  165 2 hits [enterobacteria]    selenocysteinyl-tRNA-specific translation factor [Escherich
. . . Haemophilus parasuis 29755 .....................  165 2 hits [g-proteobacteria]  DNA-directed RNA polymerase subunit beta [Haemophilus paras
. . . Escherichia coli E110019 .......................  165 2 hits [enterobacteria]    selenocysteine-specific translation elongation factor [Esch
. . . marine gamma proteobacterium HTCC2080 ..........  164 2 hits [g-proteobacteria]  selenocysteine-specific elongation factor [marine gamma pro
. . . Proteus mirabilis HI4320 .......................  164 2 hits [enterobacteria]    selenocysteine-specific elongation factor [Proteus mirabili
. . . Escherichia coli 101-1 .........................  164 2 hits [enterobacteria]    selenocysteine-specific translation elongation factor [Esch
. . . Escherichia coli O127:H6 str. E2348/69 .........  163 2 hits [enterobacteria]    selenocysteinyl-tRNA-specific translation factor [Escherich
. . . Escherichia coli O157:H7 EDL933 ................  163 2 hits [enterobacteria]    selenocysteinyl-tRNA-specific translation factor [Escherich
. . . Escherichia coli O157:H7 str. Sakai ............  163 2 hits [enterobacteria]    selenocysteinyl-tRNA-specific translation factor [Escherich
. . . Escherichia coli O157:H7 str. EC4113 ...........  163 2 hits [enterobacteria]    selenocysteinyl-tRNA-specific translation factor [Escherich
. . . Escherichia coli O157:H7 str. EC4401 ...........  163 2 hits [enterobacteria]    selenocysteinyl-tRNA-specific translation factor [Escherich
. . . Escherichia coli O157:H7 str. EC4501 ...........  163 2 hits [enterobacteria]    selenocysteinyl-tRNA-specific translation factor [Escherich
. . . Escherichia coli O157:H7 str. EC4486 ...........  163 2 hits [enterobacteria]    selenocysteinyl-tRNA-specific translation factor [Escherich
. . . Escherichia coli O157:H7 str. EC4196 ...........  163 2 hits [enterobacteria]    selenocysteinyl-tRNA-specific translation factor [Escherich
. . . Escherichia coli O157:H7 str. EC4076 ...........  163 2 hits [enterobacteria]    selenocysteinyl-tRNA-specific translation factor [Escherich
. . . Escherichia coli O157:H7 str. EC869 ............  163 2 hits [enterobacteria]    selenocysteinyl-tRNA-specific translation factor [Escherich
. . . Escherichia coli O157:H7 str. EC508 ............  163 2 hits [enterobacteria]    selenocysteinyl-tRNA-specific translation factor [Escherich
. . . Escherichia coli O157:H7 str. EC4024 ...........  163 1 hit  [enterobacteria]    selenocysteinyl-tRNA-specific translation factor [Escherich
. . . Escherichia coli O157:H7 str. EC4206 ...........  163 2 hits [enterobacteria]    selenocysteinyl-tRNA-specific translation factor [Escherich
. . . Escherichia coli O157:H7 str. EC4045 ...........  163 2 hits [enterobacteria]    selenocysteinyl-tRNA-specific translation factor [Escherich
. . . Escherichia coli O157:H7 str. EC4042 ...........  163 2 hits [enterobacteria]    selenocysteinyl-tRNA-specific translation factor [Escherich
. . . Escherichia coli O157:H7 str. EC4115 ...........  163 2 hits [enterobacteria]    selenocysteinyl-tRNA-specific translation factor [Escherich
. . . Escherichia coli O157:H7 str. TW14588 ..........  163 2 hits [enterobacteria]    selenocysteinyl-tRNA-specific translation factor [Escherich
. . . Shigella boydii Sb227 ..........................  163 2 hits [enterobacteria]    selenocysteinyl-tRNA-specific translation factor [Shigella 
. . Oligotropha carboxidovorans OM5 ------------------  227 3 hits [a-proteobacteria]  selenocysteine-specific translation elongation factor [Olig
. . Ochrobactrum anthropi ATCC 49188 .................  223 2 hits [a-proteobacteria]  selenocysteine-specific translation elongation factor [Ochr
. . Delftia acidovorans SPH-1 ........................  221 2 hits [b-proteobacteria]  selenocysteine-specific translation elongation factor [Delf
. . Comamonas testosteroni KF-1 ......................  221 2 hits [b-proteobacteria]  selenocysteine-specific translation elongation factor [Coma
. . Sinorhizobium meliloti 1021 ......................  216 2 hits [a-proteobacteria]  Selenocysteine-specific elongation factor [Sinorhizobium me
. . Burkholderia sp. H160 ............................  208 2 hits [b-proteobacteria]  selenocysteine-specific translation elongation factor [Burk
. . Burkholderia xenovorans LB400 ....................  204 2 hits [b-proteobacteria]  selenocysteine-specific translation elongation factor SelB 
. . Ralstonia eutropha H16 ...........................  201 2 hits [b-proteobacteria]  selenocysteine-specific protein translation elongation fact
. . Burkholderia pseudomallei 112 ....................  200 1 hit  [b-proteobacteria]  translation elongation factor, selenocysteine-specific [Bur
. . Burkholderia pseudomallei 1710a ..................  200 1 hit  [b-proteobacteria]  translation elongation factor, selenocysteine-specific [Bur
. . Burkholderia mallei GB8 horse 4 ..................  199 1 hit  [b-proteobacteria]  COG3276: Selenocysteine-specific translation elongation fac
. . Burkholderia mallei SAVP1 ........................  199 2 hits [b-proteobacteria]  COG3276: Selenocysteine-specific translation elongation fac
. . Burkholderia mallei NCTC 10229 ...................  199 2 hits [b-proteobacteria]  COG3276: Selenocysteine-specific translation elongation fac
. . Burkholderia pseudomallei 668 ....................  199 2 hits [b-proteobacteria]  COG3276: Selenocysteine-specific translation elongation fac
. . Burkholderia mallei NCTC 10247 ...................  199 2 hits [b-proteobacteria]  COG3276: Selenocysteine-specific translation elongation fac
. . Burkholderia mallei PRL-20 .......................  199 1 hit  [b-proteobacteria]  COG3276: Selenocysteine-specific translation elongation fac
. . Burkholderia pseudomallei NCTC 13177 .............  199 1 hit  [b-proteobacteria]  COG3276: Selenocysteine-specific translation elongation fac
. . Burkholderia mallei FMH ..........................  199 2 hits [b-proteobacteria]  COG3276: Selenocysteine-specific translation elongation fac
. . Burkholderia mallei JHU ..........................  199 2 hits [b-proteobacteria]  COG3276: Selenocysteine-specific translation elongation fac
. . Burkholderia mallei 2002721280 ...................  199 2 hits [b-proteobacteria]  COG3276: Selenocysteine-specific translation elongation fac
. . Burkholderia pseudomallei B7210 ..................  199 1 hit  [b-proteobacteria]  translation elongation factor, selenocysteine-specific [Bur
. . Burkholderia pseudomallei 576 ....................  199 2 hits [b-proteobacteria]  translation elongation factor, selenocysteine-specific [Bur
. . Burkholderia pseudomallei 9 ......................  199 1 hit  [b-proteobacteria]  translation elongation factor, selenocysteine-specific [Bur
. . Burkholderia mallei ATCC 23344 ...................  199 2 hits [b-proteobacteria]  selenocysteine-specific translation elongation factor [Burk
. . Burkholderia mallei ATCC 10399 ...................  199 2 hits [b-proteobacteria]  selenocysteine-specific translation elongation factor [Burk
. . Burkholderia pseudomallei 1106a ..................  199 2 hits [b-proteobacteria]  translation elongation factor, selenocysteine-specific [Bur
. . Burkholderia pseudomallei 1106b ..................  199 1 hit  [b-proteobacteria]  translation elongation factor, selenocysteine-specific [Bur
. . Burkholderia pseudomallei 1710b ..................  199 2 hits [b-proteobacteria]  selenocysteine-specific translation elongation factor [Burk
. . Burkholderia pseudomallei 1655 ...................  199 2 hits [b-proteobacteria]  translation elongation factor, selenocysteine-specific [Bur
. . Burkholderia pseudomallei K96243 .................  199 2 hits [b-proteobacteria]  selenocysteine-specific elongation factor [Burkholderia pse
. . Burkholderia pseudomallei 14 .....................  199 1 hit  [b-proteobacteria]  translation elongation factor, selenocysteine-specific [Bur
. . Burkholderia pseudomallei Pasteur 52237 ..........  199 2 hits [b-proteobacteria]  translation elongation factor, selenocysteine-specific [Bur
. . Burkholderia pseudomallei 406e ...................  199 2 hits [b-proteobacteria]  translation elongation factor, selenocysteine-specific [Bur
. . Burkholderia pseudomallei S13 ....................  199 2 hits [b-proteobacteria]  translation elongation factor, selenocysteine-specific [Bur
. . Burkholderia pseudomallei BCC215 .................  199 1 hit  [b-proteobacteria]  translation elongation factor, selenocysteine-specific [Bur
. . Burkholderia pseudomallei 7894 ...................  199 1 hit  [b-proteobacteria]  translation elongation factor, selenocysteine-specific [Bur
. . Burkholderia pseudomallei 305 ....................  198 2 hits [b-proteobacteria]  translation elongation factor, selenocysteine-specific [Bur
. . Burkholderia phytofirmans PsJN ...................  197 2 hits [b-proteobacteria]  selenocysteine-specific translation elongation factor [Burk
. . Burkholderia phymatum STM815 .....................  197 2 hits [b-proteobacteria]  selenocysteine-specific translation elongation factor [Burk
. . Burkholderia oklahomensis EO147 ..................  197 1 hit  [b-proteobacteria]  selenocysteine-specific translation elongation factor [Burk
. . Burkholderia oklahomensis C6786 ..................  197 1 hit  [b-proteobacteria]  selenocysteine-specific translation elongation factor [Burk
. . Paracoccus denitrificans PD1222 ..................  195 3 hits [a-proteobacteria]  Translation elongation factor, selenocysteine-specific:Smal
. . Burkholderia thailandensis MSMB43 ................  195 1 hit  [b-proteobacteria]  selenocysteine-specific translation elongation factor [Burk
. . Dechloromonas aromatica RCB ......................  192 2 hits [b-proteobacteria]  selenocysteine-specific translation elongation factor SelB 
. . Azorhizobium caulinodans ORS 571 .................  192 2 hits [a-proteobacteria]  translation elongation factor [Azorhizobium caulinodans ORS
. . Burkholderia cenocepacia J2315 ...................  187 2 hits [b-proteobacteria]  putative selenocysteine-specific elongation factor [Burkhol
. . Burkholderia ambifaria MEX-5 .....................  187 2 hits [b-proteobacteria]  selenocysteine-specific translation elongation factor [Burk
. . Burkholderia thailandensis TXDOH .................  187 1 hit  [b-proteobacteria]  selenocysteine-specific translation elongation factor [Burk
. . Burkholderia cenocepacia AU 1054 .................  187 2 hits [b-proteobacteria]  selenocysteine-specific translation elongation factor [Burk
. . Burkholderia cenocepacia HI2424 ..................  187 2 hits [b-proteobacteria]  selenocysteine-specific translation elongation factor [Burk
. . Burkholderia cenocepacia MC0-3 ...................  187 2 hits [b-proteobacteria]  selenocysteine-specific translation elongation factor [Burk
. . Burkholderia ambifaria MC40-6 ....................  186 2 hits [b-proteobacteria]  selenocysteine-specific translation elongation factor [Burk
. . Burkholderia thailandensis E264 ..................  186 2 hits [b-proteobacteria]  selenocysteine-specific translation elongation factor [Burk
. . Burkholderia ubonensis Bu ........................  186 1 hit  [b-proteobacteria]  selenocysteine-specific translation elongation factor [Burk
. . Burkholderia thailandensis Bt4 ...................  186 1 hit  [b-proteobacteria]  selenocysteine-specific translation elongation factor [Burk
. . Burkholderia vietnamiensis G4 ....................  185 2 hits [b-proteobacteria]  selenocysteine-specific translation elongation factor SelB 
. . Burkholderia sp. 383 .............................  184 2 hits [b-proteobacteria]  selenocysteine-specific translation elongation factor SelB 
. . Burkholderia ambifaria AMMD ......................  182 2 hits [b-proteobacteria]  selenocysteine-specific translation elongation factor [Burk
. . Burkholderia multivorans CGD2M ...................  181 2 hits [b-proteobacteria]  selenocysteine-specific translation elongation factor [Burk
. . Burkholderia multivorans CGD2 ....................  181 2 hits [b-proteobacteria]  selenocysteine-specific translation elongation factor [Burk
. . Burkholderia multivorans CGD1 ....................  181 2 hits [b-proteobacteria]  selenocysteine-specific translation elongation factor [Burk
. . Burkholderia multivorans ATCC 17616 ..............  181 4 hits [b-proteobacteria]  selenocysteine-specific translation elongation factor [Burk
. . Methylocella silvestris BL2 ......................  181 2 hits [a-proteobacteria]  selenocysteine-specific translation elongation factor [Meth
. . Geobacter sp. FRC-32 .............................  175 2 hits [d-proteobacteria]  selenocysteine-specific translation elongation factor [Geob
. . Desulfuromonas acetoxidans DSM 684 ...............  173 4 hits [d-proteobacteria]  selenocysteine-specific translation elongation factor [Desu
. . Geobacter metallireducens GS-15 ..................  172 2 hits [d-proteobacteria]  selenocysteine-specific translation elongation factor SelB 
. . Geobacter sp. M21 ................................  171 2 hits [d-proteobacteria]  selenocysteine-specific translation elongation factor [Geob
. . Geobacter bemidjiensis Bem .......................  171 2 hits [d-proteobacteria]  selenocysteine-specific translation elongation factor [Geob
. . Geobacter lovleyi SZ .............................  169 2 hits [d-proteobacteria]  selenocysteine-specific translation elongation factor [Geob
. . Geobacter uraniireducens Rf4 .....................  168 2 hits [d-proteobacteria]  selenocysteine-specific translation elongation factor [Geob
. . Bordetella avium 197N ............................  167 2 hits [b-proteobacteria]  selenocysteine-specific elongation factor [Bordetella avium
. . Geobacter sulfurreducens PCA .....................  167 2 hits [d-proteobacteria]  selenocysteine-specific translation elongation factor [Geob
. . Pelobacter carbinolicus DSM 2380 .................  166 2 hits [d-proteobacteria]  selenocysteine-specific translation elongation factor [Pelo
. Clostridium botulinum A3 str. Loch Maree -----------  175 2 hits [firmicutes]        selenocysteine-specific translation elongation factor [Clos
. Clostridium botulinum Bf ...........................  174 2 hits [firmicutes]        selenocysteine-specific translation elongation factor [Clos
. Clostridium botulinum F str. Langeland .............  173 2 hits [firmicutes]        selenocysteine-specific translation elongation factor [Clos
. Clostridium botulinum B1 str. Okra .................  173 2 hits [firmicutes]        selenocysteine-specific translation elongation factor [Clos
. Desulfotomaculum reducens MI-1 .....................  173 2 hits [firmicutes]        selenocysteine-specific translation elongation factor [Desu
. Moorella thermoacetica ATCC 39073 ..................  173 2 hits [firmicutes]        selenocysteine-specific translation elongation factor SelB 
. Moorella thermoacetica .............................  173 3 hits [firmicutes]        selenocysteine-specific translation elongation factor SelB 
. Clostridium botulinum NCTC 2916 ....................  172 2 hits [firmicutes]        selenocysteine-specific translation elongation factor [Clos
. Clostridium botulinum A str. ATCC 3502 .............  172 2 hits [firmicutes]        selenocysteine-specific translation elongation factor [Clos
. Clostridium botulinum A str. ATCC 19397 ............  172 2 hits [firmicutes]        selenocysteine-specific translation elongation factor [Clos
. Clostridium botulinum A str. Hall ..................  172 2 hits [firmicutes]        selenocysteine-specific translation elongation factor [Clos
. Clostridium sporogenes ATCC 15579 ..................  171 2 hits [firmicutes]        hypothetical protein CLOSPO_02039 [Clostridium sporogenes A
. Carboxydothermus hydrogenoformans Z-2901 ...........  169 2 hits [firmicutes]        selenocysteine-specific translation elongation factor [Carb

>lcl|Sequence 1 ORF:1..794 Frame -3

>gi|15600001|ref|NP_253495.1| selenocysteine-specific elongation factor [Pseudomonas aeruginosa PAO1]

>gi|146280557|ref|YP_001170710.1| selenocysteine-specific elongation factor [Pseudomonas stutzeri A1501]

>gi|104779829|ref|YP_606327.1| selenocysteinyl-tRNA-specific translation factor [Pseudomonas entomophila L48]

>gi|148545780|ref|YP_001265882.1| selenocysteine-specific translation elongation factor [Pseudomonas putida F1]

>gi|77458932|ref|YP_348438.1| selenocysteine-specific translation elongation factor SelB [Pseudomonas fluorescens Pf0-1]

>gi|119478364|ref|ZP_01618372.1| selenocysteine-specific elongation factor [marine gamma proteobacterium HTCC2143]

>gi|194367038|ref|YP_002029648.1| selenocysteine-specific translation elongation factor [Stenotrophomonas maltophilia R551-3]

>gi|160898924|ref|YP_001564506.1| selenocysteine-specific translation elongation factor [Delftia acidovorans SPH-1]

>gi|116694892|ref|YP_729103.1| selenocysteine-specific protein translation elongation factor [Ralstonia eutropha H16]
>gi|221067322|ref|ZP_03543427.1| selenocysteine-specific translation elongation factor [Comamonas testosteroni KF-1]



Blastp header (from NCBI Blast)

Query ID lcl|20789

Description lcl|Sequence 1 ORF:1..794 Frame -3

Molecule type amino acid

Query Length 264



                                                                   Score     E
Sequences producing significant alignments:                       (Bits)  Value

ref|NP_253495.1|  selenocysteine-specific elongation factor [P...   240    8e-62 
ref|YP_793272.1|  selenocysteine-specific elongation factor [P...   239    2e-61 
ref|YP_001350847.1|  selenocysteine-specific elongation factor...   231    6e-59 
ref|YP_002210965.1|  selenocysteine-specific translation elong...   227    6e-58 
ref|YP_001170710.1|  selenocysteine-specific elongation factor...   226    2e-57 
ref|YP_001371406.1|  selenocysteine-specific translation elong...   223    1e-56 
ref|YP_001564506.1|  selenocysteine-specific translation elong...   221    4e-56 
ref|ZP_03543427.1|  selenocysteine-specific translation elonga...   221    7e-56
ref|YP_606327.1|  selenocysteinyl-tRNA-specific translation fa...   219    1e-55 
ref|ZP_01618372.1|  selenocysteine-specific elongation factor ...   217    9e-55
ref|NP_435253.1|  Selenocysteine-specific elongation factor [S...   216    2e-54 
ref|YP_001265882.1|  selenocysteine-specific translation elong...   213    2e-53 
ref|NP_742659.1|  selenocysteine-specific translation elongati...   212    2e-53 
ref|YP_001666784.1|  selenocysteine-specific translation elong...   210    8e-53 
ref|YP_001747423.1|  selenocysteine-specific translation elong...   210    8e-53 
ref|YP_348438.1|  selenocysteine-specific translation elongati...   209    1e-52 
ref|ZP_03268112.1|  selenocysteine-specific translation elonga...   208    3e-52
ref|YP_552795.1|  selenocysteine-specific translation elongati...   204    4e-51 
ref|YP_729103.1|  selenocysteine-specific protein translation ...   201    5e-50 
ref|ZP_02502785.1|  translation elongation factor, selenocyste...   200    8e-50
ref|ZP_02108085.1|  translation elongation factor, selenocyste...   200    1e-49
ref|ZP_00439568.1|  COG3276: Selenocysteine-specific translati...   199    1e-49
ref|ZP_02475921.1|  translation elongation factor, selenocyste...   199    1e-49
ref|ZP_02460414.1|  translation elongation factor, selenocyste...   199    1e-49
ref|YP_106245.1|  selenocysteine-specific translation elongati...   199    1e-49 
ref|YP_001076287.1|  translation elongation factor, selenocyst...   199    1e-49 
ref|YP_335884.1|  selenocysteine-specific translation elongati...   199    1e-49 
ref|YP_002031003.1|  translation elongation factor, selenocyst...   199    1e-49 
ref|YP_111668.1|  selenocysteine-specific elongation factor [B...   199    2e-49 
ref|ZP_02416167.1|  translation elongation factor, selenocyste...   199    2e-49
ref|YP_002025930.1|  translation elongation factor, selenocyst...   199    2e-49 
ref|YP_002054194.1|  translation elongation factor, selenocyst...   199    2e-49 
ref|ZP_02510626.1|  translation elongation factor, selenocyste...   199    2e-49
ref|ZP_02486408.1|  translation elongation factor, selenocyste...   199    2e-49
ref|ZP_01765323.1|  translation elongation factor, selenocyste...   198    4e-49
ref|YP_001890225.1|  selenocysteine-specific translation elong...   197    5e-49 
ref|YP_001860682.1|  selenocysteine-specific translation elong...   197    5e-49 
ref|ZP_02359262.1|  selenocysteine-specific translation elonga...   197    1e-48
ref|ZP_00630521.1|  Translation elongation factor, selenocyste...   195    3e-48
ref|ZP_02467000.1|  selenocysteine-specific translation elonga...   195    3e-48
ref|YP_916605.1|  selenocysteine-specific translation elongati...   194    9e-48 
ref|YP_285026.1|  selenocysteine-specific translation elongati...   192    2e-47 
ref|YP_001524069.1|  translation elongation factor [Azorhizobi...   192    2e-47 
ref|YP_002233640.1|  putative selenocysteine-specific elongati...   187    8e-46 
ref|ZP_02907744.1|  selenocysteine-specific translation elonga...   187    9e-46
ref|ZP_02370164.1|  selenocysteine-specific translation elonga...   187    9e-46
ref|YP_624234.1|  selenocysteine-specific translation elongati...   187    9e-46 
ref|YP_001810567.1|  selenocysteine-specific translation elong...   186    2e-45 
ref|YP_438911.1|  selenocysteine-specific translation elongati...   186    2e-45 
ref|ZP_02380516.1|  selenocysteine-specific translation elonga...   186    2e-45
ref|ZP_02384064.1|  selenocysteine-specific translation elonga...   186    2e-45
ref|YP_001116921.1|  selenocysteine-specific translation elong...   185    4e-45 
ref|YP_372850.1|  selenocysteine-specific translation elongati...   184    8e-45 
ref|YP_775270.1|  selenocysteine-specific translation elongati...   182    2e-44 
ref|ZP_03569954.1|  selenocysteine-specific translation elonga...   181    4e-44
ref|ZP_03585486.1|  selenocysteine-specific translation elonga...   181    4e-44
ref|YP_001584562.1|  selenocysteine-specific translation elong...   181    5e-44 
ref|YP_002363600.1|  selenocysteine-specific translation elong...   181    7e-44 
ref|YP_002029648.1|  selenocysteine-specific translation elong...   176    2e-42 
ref|ZP_02958686.1|  hypothetical protein PROSTU_00436 [Provide...   176    2e-42
ref|YP_001788287.1|  selenocysteine-specific translation elong...   175    3e-42 
ref|YP_002539168.1|  selenocysteine-specific translation elong...   175    4e-42 
ref|ZP_02616323.1|  selenocysteine-specific translation elonga...   174    6e-42
ref|YP_001392251.1|  selenocysteine-specific translation elong...   173    1e-41 
ref|YP_001782608.1|  selenocysteine-specific translation elong...   173    1e-41 
ref|YP_001113525.1|  selenocysteine-specific translation elong...   173    1e-41 
ref|ZP_01313453.1|  selenocysteine-specific translation elonga...   173    1e-41
ref|YP_431328.1|  selenocysteine-specific translation elongati...   173    2e-41 
ref|ZP_02614128.1|  selenocysteine-specific translation elonga...   172    2e-41
ref|YP_386352.1|  selenocysteine-specific translation elongati...   172    2e-41 
ref|YP_001255467.1|  selenocysteine-specific translation elong...   172    2e-41 
ref|ZP_03025369.1|  selenocysteine-specific translation elonga...   171    4e-41
ref|YP_002136862.1|  selenocysteine-specific translation elong...   171    5e-41 
ref|YP_002172194.1|  selenocysteine-specific translation elong...   171    6e-41 
ref|ZP_02994918.1|  hypothetical protein CLOSPO_02039 [Clostri...   171    7e-41
ref|ZP_03320723.1|  hypothetical protein PROVALCAL_03690 [Prov...   170    1e-40
ref|ZP_01618295.1|  Translation elongation factor, selenocyste...   169    2e-40
ref|ZP_01312899.1|  selenocysteine-specific translation elonga...   169    2e-40
ref|YP_360622.1|  selenocysteine-specific translation elongati...   169    2e-40 
ref|YP_001953788.1|  selenocysteine-specific translation elong...   169    3e-40 
ref|YP_001228953.1|  selenocysteine-specific translation elong...   168    4e-40 
ref|YP_787642.1|  selenocysteine-specific elongation factor [B...   167    9e-40 
ref|NP_951164.1|  selenocysteine-specific translation elongati...   167    9e-40 
ref|YP_002384659.1|  selenocysteinyl-tRNA-specific translation...   167    1e-39 
ref|YP_001476329.1|  selenocysteinyl-tRNA-specific translation...   166    1e-39 
ref|YP_001439896.1|  selenocysteinyl-tRNA-specific translation...   166    2e-39 
ref|YP_001973542.1|  putative selenocysteine-specific elongati...   166    2e-39 
ref|NP_932049.1|  selenocysteinyl-tRNA-specific translation fa...   166    2e-39 
ref|ZP_03313312.1|  hypothetical protein PROVRUST_00072 [Provi...   166    2e-39
ref|YP_356259.1|  selenocysteine-specific translation elongati...   166    2e-39 
ref|YP_671565.1|  selenocysteinyl-tRNA-specific translation fa...   165    4e-39 
ref|ZP_02478412.1|  DNA-directed RNA polymerase subunit beta [...   165    4e-39
ref|ZP_03049434.1|  selenocysteine-specific translation elonga...   165    4e-39
ref|ZP_01625934.1|  selenocysteine-specific elongation factor ...   164    6e-39
ref|YP_002152796.1|  selenocysteine-specific elongation factor...   164    7e-39 
ref|ZP_03067699.1|  selenocysteine-specific translation elonga...   164    8e-39
ref|YP_002331304.1|  selenocysteinyl-tRNA-specific translation...   163    1e-38 
ref|NP_290170.1|  selenocysteinyl-tRNA-specific translation fa...   163    1e-38 
ref|YP_409899.1|  selenocysteinyl-tRNA-specific translation fa...   163    1e-38 
ref|YP_001723134.1|  selenocysteine-specific translation elong...   163    1e-38 

>ref|NP_253495.1|  selenocysteine-specific elongation factor [Pseudomonas aeruginosa 
 ref|ZP_01367822.1|  hypothetical protein PaerPA_01004975 [Pseudomonas aeruginosa 
 ref|YP_002442769.1|  selenocysteine-specific elongation factor [Pseudomonas aeruginosa 
 gb|AAG08193.1|AE004893_11  selenocysteine-specific elongation factor [Pseudomonas aeruginosa 
 emb|CAW29945.1|  selenocysteine-specific elongation factor [Pseudomonas aeruginosa 

 GENE ID: 880197 selB | selenocysteine-specific elongation factor
[Pseudomonas aeruginosa PAO1] (10 or fewer PubMed links)

 Score =  240 bits (613),  Expect = 8e-62, Method: Compositional matrix adjust.
 Identities = 103/264 (39%), Positives = 172/264 (65%), Gaps = 0/264 (0%)

            MPQT EHL+I++LL ++  ++ LTKID+V  +R+  V   ++ ++     + + IF +S+

             T +G++ L   L  +A     +  +G FRL+VDR F V GSGIV+TGT  SG+V+VG+E

            L+   +G  +++R +H+Q++ ++    G R +LNI G+++ +++I RGDW+L   +   T

             R+D    +L +E + F HWT +HL+LG+ +VTGR+A+L    + PG +   QLVL+ P+

             A+  D+ V+RD S+ RT+GGG +

>ref|YP_793272.1|  selenocysteine-specific elongation factor [Pseudomonas aeruginosa 
 gb|ABJ14191.1|  selenocysteine-specific elongation factor [Pseudomonas aeruginosa 

 GENE ID: 4383276 selB | selenocysteine-specific elongation factor
[Pseudomonas aeruginosa UCBPP-PA14] (10 or fewer PubMed links)

 Score =  239 bits (609),  Expect = 2e-61, Method: Compositional matrix adjust.
 Identities = 103/264 (39%), Positives = 171/264 (64%), Gaps = 0/264 (0%)

            MPQT EHL+I++LL ++  ++ LTKID+V  +R+  V   ++ ++     + + IF +S+

             T +G+  L   L  +A     +  +G FRL+VDR F V GSGIV+TGT  SG+V+VG+E

            L+   +G  +++R +H+Q++ ++    G R +LNI G+++ +++I RGDW+L   +   T

             R+D    +L +E + F HWT +HL+LG+ +VTGR+A+L    + PG +   QLVL+ P+

             A+  D+ V+RD S+ RT+GGG +

>ref|YP_001350847.1|  selenocysteine-specific elongation factor [Pseudomonas aeruginosa 
 gb|ABR84399.1|  selenocysteine-specific translation elongation factor [Pseudomonas 
aeruginosa PA7]

 GENE ID: 5354295 selB | selenocysteine-specific elongation factor
[Pseudomonas aeruginosa PA7]

 Score =  231 bits (588),  Expect = 6e-59, Method: Compositional matrix adjust.
 Identities = 102/264 (38%), Positives = 172/264 (65%), Gaps = 0/264 (0%)

            MPQT EHLSI++LL ++  ++ LTKID+V  +R+  V   ++ ++     + + IF +S+

             + +G+  L   L+ +A     +  +G FRL+VDR F V GSGIV+TGT  SG+V+VG+E

            L+   +G  +++R +H+Q++ ++    G R +LNI G+++ ++++ RGDW+L   +   T

             R+D    +L +E + F HWT +HL+LG+ +VTGR+A+L    + PG +   QLVL+ P+

             A+  D+ V+RD S+ RT+GGG +

>ref|YP_002210965.1|  selenocysteine-specific translation elongation factor [Oligotropha 
carboxidovorans OM5]
 ref|YP_002288163.1|  selenocysteine-specific translation elongation factor [Oligotropha 
carboxidovorans OM5]
 gb|ACI92298.1|  selenocysteine-specific translation elongation factor [Oligotropha 
carboxidovorans OM5]

 GENE ID: 6869628 selB | selenocysteine-specific translation elongation factor
[Oligotropha carboxidovorans OM5] (10 or fewer PubMed links)

 Score =  227 bits (579),  Expect = 6e-58, Method: Compositional matrix adjust.
 Identities = 104/262 (39%), Positives = 164/262 (62%), Gaps = 0/262 (0%)

            MPQT EHL+I+ LL +    + +TK D V+ +RL      I  ++  T   DA +F +S+

             T  GI++L +HL   A  +  +  +G FRL+VDR F + G+G V+TGTV+SG V+VG++

            ++ S SG   ++RAIH+Q++ ++ G  G RC+LN+ G++I+ D I+RGD +L   +    

            NR+DA L +L +E +    W  + L+  +  +  R+ +LG   I PG +  VQ VLD+P+

             A   D+FV+RD ++ RTIGGG

>ref|YP_001170710.1|  selenocysteine-specific elongation factor [Pseudomonas stutzeri 
 gb|ABP77868.1|  selenocysteine-specific elongation factor [Pseudomonas stutzeri 

 GENE ID: 5095238 selB | selenocysteine-specific elongation factor
[Pseudomonas stutzeri A1501] (10 or fewer PubMed links)

 Score =  226 bits (575),  Expect = 2e-57, Method: Compositional matrix adjust.
 Identities = 101/264 (38%), Positives = 167/264 (63%), Gaps = 0/264 (0%)

            MPQT EHL+I++LL ++  ++ LTKID+V   R+  V   I+ ++     + A IF +S+

                GID L + L   A     +   G+FRL++DR F V G+G+V+TGT  +G V +G+E

            L+   +G+ +++R +H+Q++++     G R +LN+ G+++ +++I RGDW+L   +   T

             R+D    +L  E    KHWT +H++LG+ +VT R+A+L   S+ PGE+   QL+L+ P 

            HAV  D+ V+RD S+ RT+GGG +

>ref|YP_001371406.1|  selenocysteine-specific translation elongation factor [Ochrobactrum 
anthropi ATCC 49188]
 gb|ABS15577.1|  selenocysteine-specific translation elongation factor [Ochrobactrum 
anthropi ATCC 49188]

 GENE ID: 5381686 Oant_2869 | selenocysteine-specific translation elongation
factor [Ochrobactrum anthropi ATCC 49188]

 Score =  223 bits (569),  Expect = 1e-56, Method: Compositional matrix adjust.
 Identities = 110/262 (41%), Positives = 164/262 (62%), Gaps = 0/262 (0%)

            MPQT EHL+I+ LL ++  + V+TK D V   RL  V   I+  +  T  +D  +  +S 

             +  GID+L + L++ A  +  +   G FRL+VDR F +KG+G V+TGTV+SG+V++G+ 

            L+ S SG+  +IR IH+Q++ S+    G RC+LN+ G  I+ + + RGD ++S  +   T

            +R+DA L IL +EKK    W  + L+  S  V  RI +L    + PG +  VQLVLD+PV

             A   D+FVIRD+S+ RTIGGG

>ref|YP_001564506.1|  selenocysteine-specific translation elongation factor [Delftia 
acidovorans SPH-1]
 gb|ABX36121.1|  selenocysteine-specific translation elongation factor [Delftia 
acidovorans SPH-1]

 GENE ID: 5749070 Daci_3485 | selenocysteine-specific translation elongation
factor [Delftia acidovorans SPH-1] (10 or fewer PubMed links)

 Score =  221 bits (564),  Expect = 4e-56, Method: Compositional matrix adjust.
 Identities = 103/266 (38%), Positives = 161/266 (60%), Gaps = 5/266 (1%)

            MPQT EHL ILQLL V+   + LTK D+   +RL  V   I  ++  T  + A +F  + 

                  G+  L  HL   A +   +   G FRL+VDR F + G G V+TGTV  G+V VG

            + L+HS SG  +++R++H+Q++ S+ G+ G RC+LN++G  I  + I+RGDWI    +  

             ++R+D  L +L +   + + W+ +H+++G+   T  +A+L    ++PGE+ IVQLVLD 

            PVHA   D+ ++R+  +SRTI GG +

>ref|ZP_03543427.1|  selenocysteine-specific translation elongation factor [Comamonas 
testosteroni KF-1]
 gb|EED67713.1|  selenocysteine-specific translation elongation factor [Comamonas 
testosteroni KF-1]

 Score =  221 bits (562),  Expect = 7e-56, Method: Compositional matrix adjust.
 Identities = 109/266 (40%), Positives = 168/266 (63%), Gaps = 5/266 (1%)

            MPQT EHL ILQLL V+   + LTK+D+V  +R+ +V   I  ++  T  +D+ IF    

            +   + G+  L  HL++ A     +   G FRL+VDR F + G G V+TGTV +G+V VG

            + L HS SG+++++R+IH+Q++ S +G+ G RC+LN+ G  I  D+I RGDWI+   +  

             T+RLD  L +L +E  +   WT +H++LG+   TG +A+L   +I PG +  VQLVL+ 

            PV A+  D+ ++R+  +SRTI GG +

>ref|YP_606327.1|  selenocysteinyl-tRNA-specific translation factor [Pseudomonas 
entomophila L48]
 emb|CAK13512.1|  selenocysteinyl-tRNA-specific translation factor [Pseudomonas 
entomophila L48]

 GENE ID: 4087051 selB | selenocysteinyl-tRNA-specific translation factor
[Pseudomonas entomophila L48] (10 or fewer PubMed links)

 Score =  219 bits (559),  Expect = 1e-55, Method: Compositional matrix adjust.
 Identities = 95/264 (35%), Positives = 173/264 (65%), Gaps = 0/264 (0%)

            MPQT EHLSI++LL +   ++V++K D+V   RL  V   + +++    ++ A  F +S+

             + +GI  L   L     +   + V+G FRL+VDR F V G+G+V+TGT ++G+VSVG+ 

            L+  K+G+ +++R +H+Q++ +     G R +LNI+ +K++ +++ RGDW+L + +   +

             R+D  L++L  E ++F+H++A+H++LG+ +VT R+A+L    +  G++   QL+L+ P+

             AV  D+ V+RD  + RT+GGG +

>ref|ZP_01618372.1|  selenocysteine-specific elongation factor [marine gamma proteobacterium 
 gb|EAW29819.1|  selenocysteine-specific elongation factor [marine gamma proteobacterium 

 Score =  217 bits (552),  Expect = 9e-55, Method: Compositional matrix adjust.
 Identities = 101/265 (38%), Positives = 173/265 (65%), Gaps = 1/265 (0%)

            MPQT EHL+ L L+ +    IV+TK D+VN ++L  V   + +++  T F+ +  F++S+

                GID L  H+   A +   +  +GNFRL+VDRRF+V G G+++TGTV SG ++V +E

            ++ S +G+  +IR++H +++       GHRC++N+TG  ITI+ ++ G WI+  +     

               D  L +L +E K  +HWT +H+++G+ ++TGR+A+L     I PG++  +Q+VL++ 

            +  +++DKF+IRD S++R IGGG+I

>ref|NP_435253.1|  Selenocysteine-specific elongation factor [Sinorhizobium meliloti 
 gb|AAK64665.1|  Selenocysteine-specific elongation factor [Sinorhizobium meliloti 

 GENE ID: 1235231 selB | Selenocysteine-specific elongation factor
[Sinorhizobium meliloti 1021] (10 or fewer PubMed links)

 Score =  216 bits (550),  Expect = 2e-54, Method: Compositional matrix adjust.
 Identities = 106/263 (40%), Positives = 162/263 (61%), Gaps = 1/263 (0%)

            PQT EHL+IL LL V   ++ +TK D  +  RL+N+   I  ++  T   DAEI  +S  

              QGI+ L   L           V G FRL+VDR F + G+G V+TGTV+SG V VG+++

              S +G S ++R+IH+Q+++++ G  G RC+LN+ G+ I+ D I+RGD ++  ++   ++

            RLDA LS+L++E K    W +   +  S     RI  L    + PGE++ VQLVLD+P+ 

            A   D+F++RD+S+ RTIGGG +

>ref|YP_001265882.1|  selenocysteine-specific translation elongation factor [Pseudomonas 
putida F1]
 gb|ABQ76698.1|  selenocysteine-specific translation elongation factor SelB [Pseudomonas 
putida F1]

 GENE ID: 5193980 Pput_0528 | selenocysteine-specific translation elongation
factor [Pseudomonas putida F1]

 Score =  213 bits (541),  Expect = 2e-53, Method: Compositional matrix adjust.
 Identities = 92/264 (34%), Positives = 169/264 (64%), Gaps = 0/264 (0%)

            MPQT EHL+I++LL +   ++ ++K D+V   RL  V   + +++    ++ A  F +S+

             + +G+D L   L         + V G FRL+VDR F V G+G+V+TGT ++G VS G+ 

            L+  K+G+ +++R +H+Q++ +     G R +LNI  +++ ++++ RGDW++ + +   +

             R+D  L++L  EK+ F+H++A+H++LG+ +VT R+A+L   S+  G++   QL+L+ P+

             AV  D+ V+RD  + RT+GGG +

>ref|NP_742659.1|  selenocysteine-specific translation elongation factor [Pseudomonas 
putida KT2440]
 gb|AAN66123.1|AE016240_8  selenocysteine-specific translation elongation factor [Pseudomonas 
putida KT2440]

 GENE ID: 1044266 selB | selenocysteine-specific translation elongation factor
[Pseudomonas putida KT2440] (10 or fewer PubMed links)

 Score =  212 bits (540),  Expect = 2e-53, Method: Compositional matrix adjust.
 Identities = 92/264 (34%), Positives = 169/264 (64%), Gaps = 0/264 (0%)

            MPQT EHL+I++LL +   ++ ++K D+V   RL  V   + +++    ++ A  F +S+

             + +G+D L   L         + V G FRL+VDR F V G+G+V+TGT ++G VS G+ 

            L+  K+G+ +++R +H+Q++ +     G R +LNI  +++ ++++ RGDW++ + +   +

             R+D  L +L +EK+ F+H++A+H++LG+ +VT R+A+L   S+  G++   QL+L+ P+

             AV  D+ V+RD  + RT+GGG +

>ref|YP_001666784.1|  selenocysteine-specific translation elongation factor [Pseudomonas 
putida GB-1]
 gb|ABY96448.1|  selenocysteine-specific translation elongation factor [Pseudomonas 
putida GB-1]

 GENE ID: 5868283 PputGB1_0537 | selenocysteine-specific translation elongation
factor [Pseudomonas putida GB-1]

 Score =  210 bits (535),  Expect = 8e-53, Method: Compositional matrix adjust.
 Identities = 91/264 (34%), Positives = 168/264 (63%), Gaps = 0/264 (0%)

            MPQT EHL+I++LL +   ++ ++K D+V   RL  V   + +++    ++ A  F +S+

             + +GI+ L   L         +  +G FRL+VDR F V G+G+V+TGT ++G VS G+ 

            L+  K+G+ +++R +H+Q++ +     G R +LNI  +++T++++ RGDW++ + +   +

             R+D  L++L  E   F+H++A+H++LG+ +VT R+A+L   S+  G++   QL+L+ P+

             AV  D+ V+RD  + RT+GGG +

>ref|YP_001747423.1|  selenocysteine-specific translation elongation factor [Pseudomonas 
putida W619]
 gb|ACA71054.1|  selenocysteine-specific translation elongation factor [Pseudomonas 
putida W619]

 GENE ID: 6109457 PputW619_0549 | selenocysteine-specific translation elongation
factor [Pseudomonas putida W619]

 Score =  210 bits (535),  Expect = 8e-53, Method: Compositional matrix adjust.
 Identities = 90/264 (34%), Positives = 169/264 (64%), Gaps = 0/264 (0%)

            MPQT EHL+I++LL +   ++ ++K D+V   R+  V   I +++    ++ A  F +S+

             T +G++ L   L         + V+G FRL++DR F V G+G+V+TGT ++G VS G+ 

            L+  K+G+++++R +H+Q++ +     G R +LNI  +++ ++++ RGDW++S+ +   +

             R+D  L +L  E + F+H++A+H++LG+ +VT R+A+L    +  G++   QL+L+ P+

             AV  D+ V+RD  + RT+GGG +

>ref|YP_348438.1|  selenocysteine-specific translation elongation factor SelB [Pseudomonas 
fluorescens Pf0-1]
 gb|ABA74448.1|  selenocysteine-specific translation elongation factor SelB [Pseudomonas 
fluorescens Pf0-1]

 GENE ID: 3714402 Pfl01_2707 | selenocysteine-specific translation elongation
factor SelB [Pseudomonas fluorescens PfO-1]

 Score =  209 bits (533),  Expect = 1e-52, Method: Compositional matrix adjust.
 Identities = 94/264 (35%), Positives = 169/264 (64%), Gaps = 3/264 (1%)

            MPQT EHL+I++LL +   ++ +TK D+V   R++ V   ++ ++    +++A +  +S+

             T +G+D L   L+ I      +E  G FRL++DR F V G+GIV+TGT +SG V+VG++

            L    + +++++R +H+Q++ ++    G R +LNI+  ++ + +I RG W+L++ +   T

             RLD    +L  E ++F+H+  +HL+LG+ +V  R+A+L   S++PGE+   QL+ + PV

            H V  D  ++RD S+ RT+GGG +

>ref|ZP_03268112.1|  selenocysteine-specific translation elongation factor [Burkholderia 
sp. H160]
 gb|EEA00317.1|  selenocysteine-specific translation elongation factor [Burkholderia 
sp. H160]

 Score =  208 bits (530),  Expect = 3e-52, Method: Compositional matrix adjust.
 Identities = 96/266 (36%), Positives = 166/266 (62%), Gaps = 4/266 (1%)

            MPQT EHL+I++LL ++   I LTKID+V+Q+RL  V   +   +  ++  DA +F    

            +     G+  L +HL+  A  +  K   G FRL+VDR F + G G ++TGTVV+G VSVG

            + ++ +   + +++R+IH+Q++ ++ G  G RC+LN+ G  I    I RGDWI+   +  

             + R+D +L++L +     + W  +H++LG+ +    +A+L   ++ PG++  VQLV ++

            P+ AV  D+FV+R+  ++RT+GGG++

>ref|YP_552795.1|  selenocysteine-specific translation elongation factor SelB [Burkholderia 
xenovorans LB400]
 gb|ABE33445.1|  selenocysteine-specific translation elongation factor SelB [Burkholderia 
xenovorans LB400]

 GENE ID: 4006956 Bxe_B2548 | selenocysteine-specific translation elongation
factor SelB [Burkholderia xenovorans LB400]

 Score =  204 bits (520),  Expect = 4e-51, Method: Compositional matrix adjust.
 Identities = 94/266 (35%), Positives = 164/266 (61%), Gaps = 4/266 (1%)

            MPQT EHL+I++LL ++   + LTK+D+V+ +RL  V   +   +  ++  DA +F    

              S   G+  L +HL   A  +  K   G FRL+VDR F + G G ++TGTVVSG V+VG

            + ++ +     +++R+IH+Q++ ++ G  G RC+LN+ G  I    I RGDW++   +  

             + R+D +L++L +     +HW  +H++LG+ +    +A+L   +++ G++  VQLV ++

            PV A+  D+FV+R+  ++RTIGGG++

>ref|YP_729103.1|  selenocysteine-specific protein translation elongation factor 
[Ralstonia eutropha H16]
 emb|CAJ95738.1|  Selenocysteine-specific protein translation elongation factor 
[Ralstonia eutropha H16]

 GENE ID: 4455916 selB | selenocysteine-specific protein translation elongation
factor [Ralstonia eutropha H16] (10 or fewer PubMed links)

 Score =  201 bits (511),  Expect = 5e-50, Method: Compositional matrix adjust.
 Identities = 101/268 (37%), Positives = 159/268 (59%), Gaps = 9/268 (3%)

            MPQT EHL+I+QLL ++   I LTK+D+VN  RL  V   I      ++  DA +F    

                  G++ L  HL   A     K   G FRL+VDR F + G G ++TGTVVSG + VG

            + ++ +   ES+++  IH+Q++ +  G  G RC+LN+ G    IDK  I RGDW++   +

               + R+D +L++L +   + +HW  +H++LG+ +    +A+L   ++ PG++  VQLV 

            ++PV A+  D FV+R+  +SRTIGGG +