IMPORTANT NOTICE: electrical maintenance in the Annotathon server room on Monday December 11th 2017 from 18:00 to 22:00 (Paris time, also known as Central European Summer Time GMT+1H) means no annotation will be possible during this downtime!

Forum "Conclusion"

Thread subject: Correction

[ Return to forums ]
Correction
francall
2 Dec 2007 13:57
Non evaluated contribution
Bonjour,
J'ai un petit un petit problème de compréhension avec une de vos remarque de correction qui est
la suivante:

"-très curieux tous ces ORF très longs et qui se chevauchent dans des phases distinctes"


Pourriez vous me l'expliquer différement?

Merci
Hingamp_BC07
2 Dec 2007 20:25
Game master
Sachant que sur un segment donné d'ADN, au maximum un seul cadre sur les 6 est codant, alors en général un seul cadre ne contient pas de STOP (celui qui code!). Les mêmes contraintes évolutives qui interdisent l'accumulation de mutation STOP dans le cadre codant n'agissent pas dans les 5 autre cadres et on y observe donc en général des STOP 'normalement' fréquents.

Dans votre cas sur un même segment plusieurs cadres sembleraient au premier coup d'oeil subir une pression évolutive "anti-STOP" et pourrait laisser penser que l'on a fait une découverte: un segment codant pour plusieurs protéines distinctes en phases décalées! Du jamais vu! Avant d'appeler la presse, regardez de plus près pour voir s'il n'existe pas une explication plus banale:

>ORF number 1 in reading frame 2 on the direct strand extends from base 2 to base 652.
CCCGATCCGTTCCGTGTCCCTCGCCCTGGCTGCCCTTGCGCTGGCCGGCGTTTCCACCGG
CGCGCTGGCCCAGGGCGCCGCGGCGTACCCCGACAAGCCGGTGCGCATGGTCATCCCGTT
TCCGCCGGGTGGCACGCTCGACAAGGTGGGCCGCATGCTTGCGCTCAAGCTGGGCGAGCA
GTTCGGGCACAACATCGTGGTGGACAACCGTCCGGGCGGCAACGGCATCATCGGCGGCGA
CATCGTGGCCAAGGCGCCTGGCGACGGCTACACGCTGCTGTTCAACGCCAGCACGTTCGT
GACCGCGCCCATGACCATGAAGACCACCCCGTACAAGGTGCAGACGGACTTCGCGCCCAT
CGCCTGGGTGGCATCGGCACCGTTGTCCGTCGCCATCAGCCCCAAGCTGGGCGTCAGCGA
CGTCAAGGGACTCGTCGCGCTGGCCAAGGCCCAGCCGGGCAAGCTGAACTTCGCGGTGGG
CTCGGTCGGCTCGGCCGGCCACCTGTGCACGGTCAAGCTCGAACAGGCCGCCGGCTCGGC
CATTGCCATCGTGCCGTACAAGGGCACGGGCCCCGCCATGACCGATCTGGTGGGCGGCCA
GATCGAAGGCTTCATCGACCCCGTGCTGGGCTCGGTGCAGTTCCATCGTAA

>Translation of ORF number 1 in reading frame 2 on the direct strand.
PDPFRVPRPGCPCAGRRFHRRAGPGRRGVPRQAGAHGHPVSAGWHARQGGPHACAQAGRA
VRAQHRGGQPSGRQRHHRRRHRGQGAWRRLHAAVQRQHVRDRAHDHEDHPVQGADGLRAH
RLGGIGTVVRRHQPQAGRQRRQGTRRAGQGPAGQAELRGGLGRLGRPPVHGQARTGRRLG
HCHRAVQGHGPRHDRSGGRPDRRLHRPRAGLGAVPS*

>ORF number 1 in reading frame 3 on the direct strand extends from base 3 to base 917.
CCGATCCGTTCCGTGTCCCTCGCCCTGGCTGCCCTTGCGCTGGCCGGCGTTTCCACCGGC
GCGCTGGCCCAGGGCGCCGCGGCGTACCCCGACAAGCCGGTGCGCATGGTCATCCCGTTT
CCGCCGGGTGGCACGCTCGACAAGGTGGGCCGCATGCTTGCGCTCAAGCTGGGCGAGCAG
TTCGGGCACAACATCGTGGTGGACAACCGTCCGGGCGGCAACGGCATCATCGGCGGCGAC
ATCGTGGCCAAGGCGCCTGGCGACGGCTACACGCTGCTGTTCAACGCCAGCACGTTCGTG
ACCGCGCCCATGACCATGAAGACCACCCCGTACAAGGTGCAGACGGACTTCGCGCCCATC
GCCTGGGTGGCATCGGCACCGTTGTCCGTCGCCATCAGCCCCAAGCTGGGCGTCAGCGAC
GTCAAGGGACTCGTCGCGCTGGCCAAGGCCCAGCCGGGCAAGCTGAACTTCGCGGTGGGC
TCGGTCGGCTCGGCCGGCCACCTGTGCACGGTCAAGCTCGAACAGGCCGCCGGCTCGGCC
ATTGCCATCGTGCCGTACAAGGGCACGGGCCCCGCCATGACCGATCTGGTGGGCGGCCAG
ATCGAAGGCTTCATCGACCCCGTGCTGGGCTCGGTGCAGTTCCATCGTAACGGGCAGCTC
AAAATCGTGGGCGTCACGTCGGCCAAACGCCTGCCCAACCTGCCCGACGTGCCGACGGTG
GCCGAAACGCTGCCGGGCTTCGAATGCGCAAGCTGGTACGGTCTGTGGGCGCCGGCCAGA
ACGCCTGCCGACATCGTTCAGAAACTCAACGCCGCCGTGAACAAGCGCTGGCCGGTGACA
TGCGCGAGCGGCTGGTCGCCGACGGCATCGTGCCCGGCGGCGGCAGCGTGGCCGAGTTCA
CCAAGTTCCAGGCCG

>Translation of ORF number 1 in reading frame 3 on the direct strand.
PIRSVSLALAALALAGVSTGALAQGAAAYPDKPVRMVIPFPPGGTLDKVGRMLALKLGEQ
FGHNIVVDNRPGGNGIIGGDIVAKAPGDGYTLLFNASTFVTAPMTMKTTPYKVQTDFAPI
AWVASAPLSVAISPKLGVSDVKGLVALAKAQPGKLNFAVGSVGSAGHLCTVKLEQAAGSA
IAIVPYKGTGPAMTDLVGGQIEGFIDPVLGSVQFHRNGQLKIVGVTSAKRLPNLPDVPTV
AETLPGFECASWYGLWAPARTPADIVQKLNAAVNKRWPVTCASGWSPTASCPAAAAWPSS
PSSRP

>ORF number 1 in reading frame 2 on the reverse strand extends from base 20 to base 916.
ACTCGGCCACGCTGCCGCCGCCGGGCACGATGCCGTCGGCGACCAGCCGCTCGCGCATGT
CACCGGCCAGCGCTTGTTCACGGCGGCGTTGAGTTTCTGAACGATGTCGGCAGGCGTTCT
GGCCGGCGCCCACAGACCGTACCAGCTTGCGCATTCGAAGCCCGGCAGCGTTTCGGCCAC
CGTCGGCACGTCGGGCAGGTTGGGCAGGCGTTTGGCCGACGTGACGCCCACGATTTTGAG
CTGCCCGTTACGATGGAACTGCACCGAGCCCAGCACGGGGTCGATGAAGCCTTCGATCTG
GCCGCCCACCAGATCGGTCATGGCGGGGCCCGTGCCCTTGTACGGCACGATGGCAATGGC
CGAGCCGGCGGCCTGTTCGAGCTTGACCGTGCACAGGTGGCCGGCCGAGCCGACCGAGCC
CACCGCGAAGTTCAGCTTGCCCGGCTGGGCCTTGGCCAGCGCGACGAGTCCCTTGACGTC
GCTGACGCCCAGCTTGGGGCTGATGGCGACGGACAACGGTGCCGATGCCACCCAGGCGAT
GGGCGCGAAGTCCGTCTGCACCTTGTACGGGGTGGTCTTCATGGTCATGGGCGCGGTCAC
GAACGTGCTGGCGTTGAACAGCAGCGTGTAGCCGTCGCCAGGCGCCTTGGCCACGATGTC
GCCGCCGATGATGCCGTTGCCGCCCGGACGGTTGTCCACCACGATGTTGTGCCCGAACTG
CTCGCCCAGCTTGAGCGCAAGCATGCGGCCCACCTTGTCGAGCGTGCCACCCGGCGGAAA
CGGGATGACCATGCGCACCGGCTTGTCGGGGTACGCCGCGGCGCCCTGGGCCAGCGCGCC
GGTGGAAACGCCGGCCAGCGCAAGGGCAGCCAGGGCGAGGGACACGGAACGGATCGG

>Translation of ORF number 1 in reading frame 2 on the reverse strand.
TRPRCRRRARCRRRPAARACHRPALVHGGVEFLNDVGRRSGRRPQTVPACAFEARQRFGH
RRHVGQVGQAFGRRDAHDFELPVTMELHRAQHGVDEAFDLAAHQIGHGGARALVRHDGNG
RAGGLFELDRAQVAGRADRAHREVQLARLGLGQRDESLDVADAQLGADGDGQRCRCHPGD
GREVRLHLVRGGLHGHGRGHERAGVEQQRVAVARRLGHDVAADDAVAARTVVHHDVVPEL
LAQLERKHAAHLVERATRRKRDDHAHRLVGVRRGALGQRAGGNAGQRKGSQGEGHGTDR